ID: 1000534755

View in Genome Browser
Species Human (GRCh38)
Location 5:162466183-162466205
Sequence ATTCTGTTCTGCTCCATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000534755_1000534758 2 Left 1000534755 5:162466183-162466205 CCCTTGATGGAGCAGAACAGAAT No data
Right 1000534758 5:162466208-162466230 TATTTGACATTCACTGGATTTGG No data
1000534755_1000534757 -4 Left 1000534755 5:162466183-162466205 CCCTTGATGGAGCAGAACAGAAT No data
Right 1000534757 5:162466202-162466224 GAATCGTATTTGACATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000534755 Original CRISPR ATTCTGTTCTGCTCCATCAA GGG (reversed) Intergenic
No off target data available for this crispr