ID: 1000534984

View in Genome Browser
Species Human (GRCh38)
Location 5:162468870-162468892
Sequence CCATAAGCACATAAGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000534984_1000534988 -9 Left 1000534984 5:162468870-162468892 CCATGTTGCTTATGTGCTTATGG No data
Right 1000534988 5:162468884-162468906 TGCTTATGGGTCAGGCCTTTTGG No data
1000534984_1000534991 2 Left 1000534984 5:162468870-162468892 CCATGTTGCTTATGTGCTTATGG No data
Right 1000534991 5:162468895-162468917 CAGGCCTTTTGGGGCATTTCAGG No data
1000534984_1000534989 -8 Left 1000534984 5:162468870-162468892 CCATGTTGCTTATGTGCTTATGG No data
Right 1000534989 5:162468885-162468907 GCTTATGGGTCAGGCCTTTTGGG No data
1000534984_1000534990 -7 Left 1000534984 5:162468870-162468892 CCATGTTGCTTATGTGCTTATGG No data
Right 1000534990 5:162468886-162468908 CTTATGGGTCAGGCCTTTTGGGG No data
1000534984_1000534993 17 Left 1000534984 5:162468870-162468892 CCATGTTGCTTATGTGCTTATGG No data
Right 1000534993 5:162468910-162468932 ATTTCAGGTACCGATGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000534984 Original CRISPR CCATAAGCACATAAGCAACA TGG (reversed) Intergenic
No off target data available for this crispr