ID: 1000552567

View in Genome Browser
Species Human (GRCh38)
Location 5:162685162-162685184
Sequence TATGGCACCCAGCAGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000552563_1000552567 11 Left 1000552563 5:162685128-162685150 CCATGCAGCTACAAGCGAAGCAA No data
Right 1000552567 5:162685162-162685184 TATGGCACCCAGCAGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000552567 Original CRISPR TATGGCACCCAGCAGAAACC AGG Intergenic