ID: 1000560723

View in Genome Browser
Species Human (GRCh38)
Location 5:162785543-162785565
Sequence GGCATATCACCTTCCTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000560723_1000560728 30 Left 1000560723 5:162785543-162785565 CCATTACAGGAAGGTGATATGCC No data
Right 1000560728 5:162785596-162785618 AACAGCTTTCAAAGACCATAAGG No data
1000560723_1000560725 -7 Left 1000560723 5:162785543-162785565 CCATTACAGGAAGGTGATATGCC No data
Right 1000560725 5:162785559-162785581 ATATGCCAAGGATTGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000560723 Original CRISPR GGCATATCACCTTCCTGTAA TGG (reversed) Intergenic
No off target data available for this crispr