ID: 1000563696

View in Genome Browser
Species Human (GRCh38)
Location 5:162822220-162822242
Sequence CAGGCTCTGGCTTCCATCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000563696_1000563704 29 Left 1000563696 5:162822220-162822242 CCACCGATGGAAGCCAGAGCCTG No data
Right 1000563704 5:162822272-162822294 TTGTTTCTTTTCTCGGCAGATGG No data
1000563696_1000563703 22 Left 1000563696 5:162822220-162822242 CCACCGATGGAAGCCAGAGCCTG No data
Right 1000563703 5:162822265-162822287 TTGGTAGTTGTTTCTTTTCTCGG No data
1000563696_1000563700 3 Left 1000563696 5:162822220-162822242 CCACCGATGGAAGCCAGAGCCTG No data
Right 1000563700 5:162822246-162822268 TAAAAACATCCTCTCCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000563696 Original CRISPR CAGGCTCTGGCTTCCATCGG TGG (reversed) Intergenic
No off target data available for this crispr