ID: 1000570398

View in Genome Browser
Species Human (GRCh38)
Location 5:162905571-162905593
Sequence AATAACTAAAAGGATATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000570396_1000570398 2 Left 1000570396 5:162905546-162905568 CCTAAAAAACATGTAGTGGGTAT No data
Right 1000570398 5:162905571-162905593 AATAACTAAAAGGATATAGAAGG No data
1000570395_1000570398 3 Left 1000570395 5:162905545-162905567 CCCTAAAAAACATGTAGTGGGTA No data
Right 1000570398 5:162905571-162905593 AATAACTAAAAGGATATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000570398 Original CRISPR AATAACTAAAAGGATATAGA AGG Intergenic
No off target data available for this crispr