ID: 1000571421

View in Genome Browser
Species Human (GRCh38)
Location 5:162918866-162918888
Sequence GTGGATAACCAACACCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000571419_1000571421 -3 Left 1000571419 5:162918846-162918868 CCAATTTCACTATCTTCTATGTG 0: 1
1: 1
2: 1
3: 31
4: 343
Right 1000571421 5:162918866-162918888 GTGGATAACCAACACCATTTTGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000571421 Original CRISPR GTGGATAACCAACACCATTT TGG Intergenic
903437454 1:23361764-23361786 GTGAATAAAAATCACCATTTTGG + Exonic
909182602 1:72444224-72444246 GTTTATAACTATCACCATTTGGG - Intergenic
911477466 1:98391185-98391207 TTGGAATAGCAACACCATTTGGG - Intergenic
912219428 1:107655942-107655964 GAGGATAACAAACACCAGTGAGG + Intronic
918953472 1:191172961-191172983 GGGGATTATTAACACCATTTTGG + Intergenic
921871475 1:220145205-220145227 GAGGATAATAAACACCATATAGG + Intronic
1063775420 10:9257990-9258012 ATGGATAATCAACAACATTCAGG - Intergenic
1071233083 10:83611773-83611795 CTGGAGTACCAACACCAGTTTGG - Intergenic
1076173035 10:128338868-128338890 GTGGATATCCACCACCATTCTGG - Intergenic
1086120424 11:83299856-83299878 GTTGTTAACCAACCGCATTTTGG + Intergenic
1087991691 11:104751267-104751289 GGTGATAACCAGCACCAATTTGG + Intergenic
1089137822 11:116263667-116263689 GGGGATAAATAACACCAATTGGG + Intergenic
1089671989 11:120063009-120063031 GAGGATAACCGCCAGCATTTGGG - Intergenic
1092598671 12:10035024-10035046 GGGGAAAACCATCACCCTTTTGG - Intronic
1098069336 12:66655183-66655205 GAGGATAACAACCCCCATTTGGG - Intronic
1098737436 12:74124621-74124643 CTGGAAAACCAACACCTCTTAGG + Intergenic
1109327038 13:60880202-60880224 GTGAATAAGAAACACCTTTTTGG + Intergenic
1114416613 14:22549080-22549102 GGAGGTAACCAACACCATTCAGG + Intergenic
1116809298 14:49523946-49523968 GTGCATAACAACTACCATTTAGG - Intergenic
1117078366 14:52126716-52126738 TTGGAAACCCAACAGCATTTAGG + Intergenic
1119465743 14:74856858-74856880 GCGGAGAACCACCAGCATTTTGG + Exonic
1120346686 14:83299306-83299328 GTTAATAACAAACAGCATTTCGG + Intergenic
1123955001 15:25326014-25326036 GGGGATAACCAAAAGCACTTTGG - Intergenic
1124840918 15:33241355-33241377 CTGGAAAACCAACAGCATTCAGG - Intergenic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1136589610 16:31209856-31209878 GTGGATAAATAACACCATCCTGG - Intergenic
1137871099 16:51951231-51951253 GTGGATAACCACCTCTAGTTCGG + Intergenic
1146819093 17:35970066-35970088 ATGCATAACCAACACCACTCTGG - Intergenic
1149941712 17:60876688-60876710 TTTGTTAACCAACACCGTTTTGG + Intronic
1153706736 18:7753061-7753083 GTAGAGAACCAAAACCAGTTTGG + Intronic
1156856522 18:41788556-41788578 CTCGATGACCAACACCATTCAGG - Intergenic
930766919 2:55094034-55094056 GTCCATAACAAACACCATTATGG - Intronic
933406226 2:81863368-81863390 GTGCAAAACCATCACAATTTTGG - Intergenic
939104208 2:137930179-137930201 GTGGCTTCCCACCACCATTTGGG - Intergenic
1184196214 22:42930655-42930677 TTGGATAACCAAAACCATGGAGG - Intronic
950502602 3:13373728-13373750 GTGCAGAACCCACTCCATTTCGG - Exonic
954866145 3:53731774-53731796 GTGGTTAGCCAGCACCATTCAGG - Intronic
963020054 3:140864248-140864270 GTGGAAATCCAACAGGATTTGGG + Intergenic
965639885 3:170820521-170820543 GTGGATAGGCAAAACAATTTGGG + Intronic
969886922 4:10223190-10223212 GTAGATGACCAAGACAATTTTGG + Intergenic
974410545 4:61536120-61536142 TTGGATAAACAACAACATTAAGG - Intronic
975387735 4:73777904-73777926 GAGGAAAGCCAACACCCTTTTGG - Intergenic
981332355 4:143526599-143526621 GTGGATAAAAAACAGCACTTTGG + Intronic
985368129 4:189255358-189255380 ATGTATAACCAGCAGCATTTGGG - Intergenic
987486988 5:18536828-18536850 GTGGATAGGCAAAACAATTTGGG - Intergenic
987497973 5:18671416-18671438 GTGGATAGGCAAAACAATTTGGG + Intergenic
988122974 5:26991893-26991915 TTCTATCACCAACACCATTTGGG + Intronic
989784395 5:45310071-45310093 GAAGATAACCAATACCATTCAGG + Intronic
994847539 5:105009059-105009081 ATGGATAGCTTACACCATTTGGG - Intergenic
994969040 5:106712255-106712277 GTGGATGACCAGAAACATTTCGG - Intergenic
995721426 5:115138567-115138589 GGGGATAAGAAAAACCATTTAGG + Intronic
998125906 5:139621440-139621462 GTGTATGACCATCCCCATTTAGG + Intronic
999408078 5:151324856-151324878 GTGGAAAACAAAAACCAATTGGG - Intronic
999637667 5:153639637-153639659 GTGAATAAACAAGGCCATTTTGG - Intronic
999660526 5:153858080-153858102 AGGGAAACCCAACACCATTTTGG - Intergenic
1000331256 5:160207341-160207363 ATGGATAACCAAGACATTTTAGG + Intronic
1000571421 5:162918866-162918888 GTGGATAACCAACACCATTTTGG + Intergenic
1005155544 6:22801988-22802010 GAGGTTACCCAACACCATATGGG + Intergenic
1014310050 6:119788283-119788305 CTTGATAACCAACTCCAATTTGG + Intergenic
1020712982 7:11631804-11631826 TTAGATAAGCAACACCATTTTGG + Intronic
1026217976 7:68366344-68366366 GTGGAAAACCCACACAAGTTTGG - Intergenic
1036134010 8:6142164-6142186 GAGGTTAAACATCACCATTTGGG - Intergenic
1041949312 8:63483178-63483200 GTGGAAAAGCAACACTATTATGG - Intergenic
1043357397 8:79429006-79429028 GAGGATAACCCTCACCATTTGGG - Intergenic
1043438141 8:80253919-80253941 GTGGAGAACCCACTCCTTTTGGG - Intergenic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1045568816 8:103349130-103349152 GAGGATAATGAACAACATTTGGG - Intergenic
1045666854 8:104497267-104497289 GAGGATAACAGACACCATTTCGG + Exonic
1052774100 9:32716467-32716489 ATGGATAACCAGCAGCCTTTGGG + Intergenic
1055770179 9:79708626-79708648 GTCCATATCCAACTCCATTTGGG + Exonic
1058666133 9:107317653-107317675 GAGGATAACCAAATCCAGTTTGG + Intronic
1059055967 9:110979915-110979937 TTGGATAACCAAGAGCATTTAGG + Intronic
1059728778 9:117035619-117035641 GTGGATAATAAAGACCACTTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic