ID: 1000571812

View in Genome Browser
Species Human (GRCh38)
Location 5:162924170-162924192
Sequence ACTGATTTGACAACAGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000571812_1000571819 5 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571819 5:162924198-162924220 TGTGGAGGGAAGGAGGGCCCAGG No data
1000571812_1000571816 -5 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571816 5:162924188-162924210 TCAGTGTGTTTGTGGAGGGAAGG No data
1000571812_1000571814 -10 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571814 5:162924183-162924205 TCAAATCAGTGTGTTTGTGGAGG No data
1000571812_1000571818 -1 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571818 5:162924192-162924214 TGTGTTTGTGGAGGGAAGGAGGG No data
1000571812_1000571817 -2 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG No data
1000571812_1000571815 -9 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571815 5:162924184-162924206 CAAATCAGTGTGTTTGTGGAGGG No data
1000571812_1000571820 6 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571820 5:162924199-162924221 GTGGAGGGAAGGAGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000571812 Original CRISPR ACTGATTTGACAACAGTTCA TGG (reversed) Intergenic
No off target data available for this crispr