ID: 1000571817

View in Genome Browser
Species Human (GRCh38)
Location 5:162924191-162924213
Sequence GTGTGTTTGTGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000571812_1000571817 -2 Left 1000571812 5:162924170-162924192 CCATGAACTGTTGTCAAATCAGT No data
Right 1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000571817 Original CRISPR GTGTGTTTGTGGAGGGAAGG AGG Intergenic
No off target data available for this crispr