ID: 1000573893

View in Genome Browser
Species Human (GRCh38)
Location 5:162951928-162951950
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000573890_1000573893 13 Left 1000573890 5:162951892-162951914 CCTGAGACTGACAATTTACAAAA No data
Right 1000573893 5:162951928-162951950 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000573893 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr