ID: 1000575979

View in Genome Browser
Species Human (GRCh38)
Location 5:162975788-162975810
Sequence CCTTATAAGCAGAAGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000575979_1000575987 16 Left 1000575979 5:162975788-162975810 CCACCTTGCTTCTGCTTATAAGG No data
Right 1000575987 5:162975827-162975849 CCTTCCTTATCAAGGAGACCAGG No data
1000575979_1000575985 8 Left 1000575979 5:162975788-162975810 CCACCTTGCTTCTGCTTATAAGG No data
Right 1000575985 5:162975819-162975841 CCACACAGCCTTCCTTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000575979 Original CRISPR CCTTATAAGCAGAAGCAAGG TGG (reversed) Intergenic
No off target data available for this crispr