ID: 1000576063

View in Genome Browser
Species Human (GRCh38)
Location 5:162976404-162976426
Sequence CTGCATTACAACTTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000576063_1000576073 17 Left 1000576063 5:162976404-162976426 CCCTGCCCCAAGTTGTAATGCAG No data
Right 1000576073 5:162976444-162976466 GATGCCTGCATCATGCTCTTGGG No data
1000576063_1000576072 16 Left 1000576063 5:162976404-162976426 CCCTGCCCCAAGTTGTAATGCAG No data
Right 1000576072 5:162976443-162976465 AGATGCCTGCATCATGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000576063 Original CRISPR CTGCATTACAACTTGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr