ID: 1000576073

View in Genome Browser
Species Human (GRCh38)
Location 5:162976444-162976466
Sequence GATGCCTGCATCATGCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000576066_1000576073 11 Left 1000576066 5:162976410-162976432 CCCAAGTTGTAATGCAGCAAGAA No data
Right 1000576073 5:162976444-162976466 GATGCCTGCATCATGCTCTTGGG No data
1000576063_1000576073 17 Left 1000576063 5:162976404-162976426 CCCTGCCCCAAGTTGTAATGCAG No data
Right 1000576073 5:162976444-162976466 GATGCCTGCATCATGCTCTTGGG No data
1000576065_1000576073 12 Left 1000576065 5:162976409-162976431 CCCCAAGTTGTAATGCAGCAAGA No data
Right 1000576073 5:162976444-162976466 GATGCCTGCATCATGCTCTTGGG No data
1000576067_1000576073 10 Left 1000576067 5:162976411-162976433 CCAAGTTGTAATGCAGCAAGAAG No data
Right 1000576073 5:162976444-162976466 GATGCCTGCATCATGCTCTTGGG No data
1000576062_1000576073 27 Left 1000576062 5:162976394-162976416 CCATCTGATGCCCTGCCCCAAGT No data
Right 1000576073 5:162976444-162976466 GATGCCTGCATCATGCTCTTGGG No data
1000576064_1000576073 16 Left 1000576064 5:162976405-162976427 CCTGCCCCAAGTTGTAATGCAGC No data
Right 1000576073 5:162976444-162976466 GATGCCTGCATCATGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000576073 Original CRISPR GATGCCTGCATCATGCTCTT GGG Intergenic
No off target data available for this crispr