ID: 1000582237

View in Genome Browser
Species Human (GRCh38)
Location 5:163048618-163048640
Sequence CCTGGAAGGAGCCTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000582237_1000582245 21 Left 1000582237 5:163048618-163048640 CCTGGCTTCAGGCTCCTTCCAGG No data
Right 1000582245 5:163048662-163048684 CTGTTGTTCCAGGTGCCACTGGG No data
1000582237_1000582243 11 Left 1000582237 5:163048618-163048640 CCTGGCTTCAGGCTCCTTCCAGG No data
Right 1000582243 5:163048652-163048674 TTCTGTCTTGCTGTTGTTCCAGG No data
1000582237_1000582244 20 Left 1000582237 5:163048618-163048640 CCTGGCTTCAGGCTCCTTCCAGG No data
Right 1000582244 5:163048661-163048683 GCTGTTGTTCCAGGTGCCACTGG No data
1000582237_1000582246 22 Left 1000582237 5:163048618-163048640 CCTGGCTTCAGGCTCCTTCCAGG No data
Right 1000582246 5:163048663-163048685 TGTTGTTCCAGGTGCCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000582237 Original CRISPR CCTGGAAGGAGCCTGAAGCC AGG (reversed) Intergenic