ID: 1000588463

View in Genome Browser
Species Human (GRCh38)
Location 5:163129143-163129165
Sequence TGTCCTTTGCAGAACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000588459_1000588463 0 Left 1000588459 5:163129120-163129142 CCCTGTATAAAATGATCTCCTCA No data
Right 1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG No data
1000588460_1000588463 -1 Left 1000588460 5:163129121-163129143 CCTGTATAAAATGATCTCCTCAT No data
Right 1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000588463 Original CRISPR TGTCCTTTGCAGAACATGGA TGG Intergenic
No off target data available for this crispr