ID: 1000592348

View in Genome Browser
Species Human (GRCh38)
Location 5:163173616-163173638
Sequence ATAGAGAAGCCTTATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000592348_1000592354 2 Left 1000592348 5:163173616-163173638 CCTCCCTCATAAGGCTTCTCTAT No data
Right 1000592354 5:163173641-163173663 AAGTGCCAAGGCTGGGAGACTGG No data
1000592348_1000592356 27 Left 1000592348 5:163173616-163173638 CCTCCCTCATAAGGCTTCTCTAT No data
Right 1000592356 5:163173666-163173688 CAAGTCAGACAAGATTATCTAGG No data
1000592348_1000592352 -6 Left 1000592348 5:163173616-163173638 CCTCCCTCATAAGGCTTCTCTAT No data
Right 1000592352 5:163173633-163173655 CTCTATGCAAGTGCCAAGGCTGG No data
1000592348_1000592353 -5 Left 1000592348 5:163173616-163173638 CCTCCCTCATAAGGCTTCTCTAT No data
Right 1000592353 5:163173634-163173656 TCTATGCAAGTGCCAAGGCTGGG No data
1000592348_1000592351 -10 Left 1000592348 5:163173616-163173638 CCTCCCTCATAAGGCTTCTCTAT No data
Right 1000592351 5:163173629-163173651 GCTTCTCTATGCAAGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000592348 Original CRISPR ATAGAGAAGCCTTATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr