ID: 1000595415

View in Genome Browser
Species Human (GRCh38)
Location 5:163209942-163209964
Sequence TGTAGCAGGACTAAAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000595409_1000595415 20 Left 1000595409 5:163209899-163209921 CCAAGCCAAATCCGACTGAATAA No data
Right 1000595415 5:163209942-163209964 TGTAGCAGGACTAAAAATGCTGG No data
1000595410_1000595415 15 Left 1000595410 5:163209904-163209926 CCAAATCCGACTGAATAATATTT No data
Right 1000595415 5:163209942-163209964 TGTAGCAGGACTAAAAATGCTGG No data
1000595411_1000595415 9 Left 1000595411 5:163209910-163209932 CCGACTGAATAATATTTATTAAG No data
Right 1000595415 5:163209942-163209964 TGTAGCAGGACTAAAAATGCTGG No data
1000595408_1000595415 21 Left 1000595408 5:163209898-163209920 CCCAAGCCAAATCCGACTGAATA No data
Right 1000595415 5:163209942-163209964 TGTAGCAGGACTAAAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000595415 Original CRISPR TGTAGCAGGACTAAAAATGC TGG Intergenic
No off target data available for this crispr