ID: 1000600299

View in Genome Browser
Species Human (GRCh38)
Location 5:163265859-163265881
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000600299_1000600305 -4 Left 1000600299 5:163265859-163265881 CCCAGAGGATACAGGAAGCTTTG No data
Right 1000600305 5:163265878-163265900 TTTGGGATTCTAACAACGAGGGG No data
1000600299_1000600303 -6 Left 1000600299 5:163265859-163265881 CCCAGAGGATACAGGAAGCTTTG No data
Right 1000600303 5:163265876-163265898 GCTTTGGGATTCTAACAACGAGG No data
1000600299_1000600304 -5 Left 1000600299 5:163265859-163265881 CCCAGAGGATACAGGAAGCTTTG No data
Right 1000600304 5:163265877-163265899 CTTTGGGATTCTAACAACGAGGG No data
1000600299_1000600306 0 Left 1000600299 5:163265859-163265881 CCCAGAGGATACAGGAAGCTTTG No data
Right 1000600306 5:163265882-163265904 GGATTCTAACAACGAGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000600299 Original CRISPR CAAAGCTTCCTGTATCCTCT GGG (reversed) Intergenic
No off target data available for this crispr