ID: 1000600305

View in Genome Browser
Species Human (GRCh38)
Location 5:163265878-163265900
Sequence TTTGGGATTCTAACAACGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000600299_1000600305 -4 Left 1000600299 5:163265859-163265881 CCCAGAGGATACAGGAAGCTTTG No data
Right 1000600305 5:163265878-163265900 TTTGGGATTCTAACAACGAGGGG No data
1000600300_1000600305 -5 Left 1000600300 5:163265860-163265882 CCAGAGGATACAGGAAGCTTTGG No data
Right 1000600305 5:163265878-163265900 TTTGGGATTCTAACAACGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000600305 Original CRISPR TTTGGGATTCTAACAACGAG GGG Intergenic
No off target data available for this crispr