ID: 1000602211

View in Genome Browser
Species Human (GRCh38)
Location 5:163288391-163288413
Sequence CTATAGAAAAAGGTGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000602211_1000602216 10 Left 1000602211 5:163288391-163288413 CCAAGAGCCACCTTTTTCTATAG No data
Right 1000602216 5:163288424-163288446 CTTATAAAACAGGGCAGTAGTGG No data
1000602211_1000602215 1 Left 1000602211 5:163288391-163288413 CCAAGAGCCACCTTTTTCTATAG No data
Right 1000602215 5:163288415-163288437 TAGAATTTGCTTATAAAACAGGG No data
1000602211_1000602214 0 Left 1000602211 5:163288391-163288413 CCAAGAGCCACCTTTTTCTATAG No data
Right 1000602214 5:163288414-163288436 TTAGAATTTGCTTATAAAACAGG No data
1000602211_1000602217 11 Left 1000602211 5:163288391-163288413 CCAAGAGCCACCTTTTTCTATAG No data
Right 1000602217 5:163288425-163288447 TTATAAAACAGGGCAGTAGTGGG No data
1000602211_1000602218 16 Left 1000602211 5:163288391-163288413 CCAAGAGCCACCTTTTTCTATAG No data
Right 1000602218 5:163288430-163288452 AAACAGGGCAGTAGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000602211 Original CRISPR CTATAGAAAAAGGTGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr