ID: 1000603113

View in Genome Browser
Species Human (GRCh38)
Location 5:163298475-163298497
Sequence CTCCACAAGACACTTCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000603110_1000603113 26 Left 1000603110 5:163298426-163298448 CCAAGAAGAGCAGTTTCAGTAAT No data
Right 1000603113 5:163298475-163298497 CTCCACAAGACACTTCTATCAGG No data
1000603109_1000603113 27 Left 1000603109 5:163298425-163298447 CCCAAGAAGAGCAGTTTCAGTAA No data
Right 1000603113 5:163298475-163298497 CTCCACAAGACACTTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000603113 Original CRISPR CTCCACAAGACACTTCTATC AGG Intergenic
No off target data available for this crispr