ID: 1000616454

View in Genome Browser
Species Human (GRCh38)
Location 5:163433109-163433131
Sequence TTCGTGGCTTTCAGGTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000616454_1000616462 24 Left 1000616454 5:163433109-163433131 CCATAGAACCTGAAAGCCACGAA No data
Right 1000616462 5:163433156-163433178 CAGGCAGTGAAAAACAACCTTGG No data
1000616454_1000616458 5 Left 1000616454 5:163433109-163433131 CCATAGAACCTGAAAGCCACGAA No data
Right 1000616458 5:163433137-163433159 TCTGACCCTACCAACAGTACAGG No data
1000616454_1000616463 25 Left 1000616454 5:163433109-163433131 CCATAGAACCTGAAAGCCACGAA No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000616454 Original CRISPR TTCGTGGCTTTCAGGTTCTA TGG (reversed) Intergenic