ID: 1000616456

View in Genome Browser
Species Human (GRCh38)
Location 5:163433117-163433139
Sequence AGAGCCTCTTCGTGGCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000616456_1000616462 16 Left 1000616456 5:163433117-163433139 CCTGAAAGCCACGAAGAGGCTCT No data
Right 1000616462 5:163433156-163433178 CAGGCAGTGAAAAACAACCTTGG No data
1000616456_1000616463 17 Left 1000616456 5:163433117-163433139 CCTGAAAGCCACGAAGAGGCTCT No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data
1000616456_1000616458 -3 Left 1000616456 5:163433117-163433139 CCTGAAAGCCACGAAGAGGCTCT No data
Right 1000616458 5:163433137-163433159 TCTGACCCTACCAACAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000616456 Original CRISPR AGAGCCTCTTCGTGGCTTTC AGG (reversed) Intergenic