ID: 1000616457 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:163433125-163433147 |
Sequence | GTAGGGTCAGAGCCTCTTCG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1000616457_1000616462 | 8 | Left | 1000616457 | 5:163433125-163433147 | CCACGAAGAGGCTCTGACCCTAC | No data | ||
Right | 1000616462 | 5:163433156-163433178 | CAGGCAGTGAAAAACAACCTTGG | No data | ||||
1000616457_1000616463 | 9 | Left | 1000616457 | 5:163433125-163433147 | CCACGAAGAGGCTCTGACCCTAC | No data | ||
Right | 1000616463 | 5:163433157-163433179 | AGGCAGTGAAAAACAACCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1000616457 | Original CRISPR | GTAGGGTCAGAGCCTCTTCG TGG (reversed) | Intergenic | ||