ID: 1000616460

View in Genome Browser
Species Human (GRCh38)
Location 5:163433143-163433165
Sequence TCACTGCCTGTACTGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000616460_1000616467 23 Left 1000616460 5:163433143-163433165 CCTACCAACAGTACAGGCAGTGA No data
Right 1000616467 5:163433189-163433211 TTATTAGAAAACTGAGGTTTGGG No data
1000616460_1000616463 -9 Left 1000616460 5:163433143-163433165 CCTACCAACAGTACAGGCAGTGA No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data
1000616460_1000616465 17 Left 1000616460 5:163433143-163433165 CCTACCAACAGTACAGGCAGTGA No data
Right 1000616465 5:163433183-163433205 TACTAATTATTAGAAAACTGAGG No data
1000616460_1000616468 24 Left 1000616460 5:163433143-163433165 CCTACCAACAGTACAGGCAGTGA No data
Right 1000616468 5:163433190-163433212 TATTAGAAAACTGAGGTTTGGGG No data
1000616460_1000616466 22 Left 1000616460 5:163433143-163433165 CCTACCAACAGTACAGGCAGTGA No data
Right 1000616466 5:163433188-163433210 ATTATTAGAAAACTGAGGTTTGG No data
1000616460_1000616462 -10 Left 1000616460 5:163433143-163433165 CCTACCAACAGTACAGGCAGTGA No data
Right 1000616462 5:163433156-163433178 CAGGCAGTGAAAAACAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000616460 Original CRISPR TCACTGCCTGTACTGTTGGT AGG (reversed) Intergenic