ID: 1000616463

View in Genome Browser
Species Human (GRCh38)
Location 5:163433157-163433179
Sequence AGGCAGTGAAAAACAACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000616459_1000616463 -8 Left 1000616459 5:163433142-163433164 CCCTACCAACAGTACAGGCAGTG No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data
1000616457_1000616463 9 Left 1000616457 5:163433125-163433147 CCACGAAGAGGCTCTGACCCTAC No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data
1000616456_1000616463 17 Left 1000616456 5:163433117-163433139 CCTGAAAGCCACGAAGAGGCTCT No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data
1000616460_1000616463 -9 Left 1000616460 5:163433143-163433165 CCTACCAACAGTACAGGCAGTGA No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data
1000616454_1000616463 25 Left 1000616454 5:163433109-163433131 CCATAGAACCTGAAAGCCACGAA No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data
1000616453_1000616463 29 Left 1000616453 5:163433105-163433127 CCAGCCATAGAACCTGAAAGCCA No data
Right 1000616463 5:163433157-163433179 AGGCAGTGAAAAACAACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000616463 Original CRISPR AGGCAGTGAAAAACAACCTT GGG Intergenic