ID: 1000621246

View in Genome Browser
Species Human (GRCh38)
Location 5:163489234-163489256
Sequence CAGGAGGTAAGTGGTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 373}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000621246_1000621260 30 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621246_1000621258 18 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621258 5:163489275-163489297 AACAGGCCTTGGATGGGTATTGG 0: 1
1: 0
2: 7
3: 45
4: 301
1000621246_1000621256 12 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621256 5:163489269-163489291 GTTCCTAACAGGCCTTGGATGGG 0: 1
1: 23
2: 218
3: 469
4: 720
1000621246_1000621252 1 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621252 5:163489258-163489280 TCTGCAGCCGGGTTCCTAACAGG 0: 2
1: 33
2: 330
3: 752
4: 1302
1000621246_1000621249 -10 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621249 5:163489247-163489269 TTACCTCCTGCTCTGCAGCCGGG 0: 2
1: 33
2: 326
3: 597
4: 1179
1000621246_1000621253 7 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621253 5:163489264-163489286 GCCGGGTTCCTAACAGGCCTTGG 0: 1
1: 14
2: 402
3: 771
4: 906
1000621246_1000621255 11 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621255 5:163489268-163489290 GGTTCCTAACAGGCCTTGGATGG 0: 1
1: 14
2: 31
3: 66
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000621246 Original CRISPR CAGGAGGTAAGTGGTGAGCC AGG (reversed) Intronic
900381149 1:2384732-2384754 CAGGAGGTACGCGGAGAGGCAGG - Intronic
900780927 1:4616803-4616825 CAGCTGGTCTGTGGTGAGCCAGG + Intergenic
901608146 1:10475233-10475255 CAGGCGGGAAGTGGGGACCCGGG - Intronic
901769073 1:11521411-11521433 GAGGAGGGAAGGGGTTAGCCAGG + Intronic
901769148 1:11521639-11521661 GAGGAGGGAAGGGGTTAGCCAGG + Intronic
902091940 1:13910567-13910589 CAGAAGGCAAATGGGGAGCCAGG - Intergenic
902702699 1:18183489-18183511 GAGGAGGTCAGAGGTGAGCCTGG + Intronic
903567808 1:24281963-24281985 CAGCTGGTATGTGGTGAGGCTGG - Intergenic
903770174 1:25758809-25758831 CAGGAGGGCAGTGGGGAGCCCGG + Intronic
904116162 1:28163546-28163568 CAGCAAGTAAATGGTAAGCCAGG - Intronic
904451545 1:30616027-30616049 CAGGAGGCAAGTTGTGAGATGGG - Intergenic
904681670 1:32233662-32233684 CAGCAGGTGAGTGGTGAAACTGG + Intergenic
906651726 1:47517565-47517587 CTGGTGGTAGGTGGTGAGGCTGG - Intergenic
907163265 1:52387162-52387184 CAGGAGGTGAGTGGTGGGTGGGG + Intronic
907470806 1:54672251-54672273 GAGGAGGCAGGTGGTGAGCCAGG + Intronic
907473939 1:54692910-54692932 CAGGTGGCAAGTGGTAAGCTGGG - Intronic
907913491 1:58847640-58847662 CAGCTGATAAGTGGGGAGCCAGG + Intergenic
908740490 1:67322521-67322543 CAAGAGGGAAGGAGTGAGCCAGG + Intronic
909678424 1:78263841-78263863 CAGGAGTTAGGAGCTGAGCCTGG + Intergenic
910228783 1:84964900-84964922 CAGGAGGTGAGTGGTAGGCAAGG - Intronic
910803167 1:91165172-91165194 CAGGAGGGAAGAGGGCAGCCAGG + Intergenic
911086165 1:93979188-93979210 CAGGACGGAGGTGGGGAGCCAGG - Intergenic
911860302 1:102939069-102939091 CAGGGTGAAATTGGTGAGCCGGG - Exonic
913011562 1:114688544-114688566 CAGGAGGTAAGTGGTGTAAGGGG - Exonic
915409525 1:155689238-155689260 CAGGAGGTAGGGAGTGAGGCCGG + Intronic
919144844 1:193621144-193621166 AAGCAGGTCAGTGGTGAGCCAGG + Intergenic
919902949 1:202057338-202057360 AATGAGGTAGGTGGGGAGCCAGG + Intergenic
920509151 1:206538039-206538061 CAGGAGAGAAGTGGTGGGGCGGG - Intronic
921310642 1:213839721-213839743 CAGGCAGTAAGTGGACAGCCTGG - Intergenic
921675934 1:217976570-217976592 TAGGAAGTTAGTGGAGAGCCAGG + Intergenic
922100725 1:222475294-222475316 CAGGAGGCAAGAGCTGTGCCTGG + Intergenic
922733899 1:227969381-227969403 CAGGAGGCAAGAGCTGTGCCTGG - Intergenic
1063244804 10:4206758-4206780 CAGGAGGTAAATGCCGTGCCGGG - Intergenic
1063443813 10:6095420-6095442 CAGGAGTTAAGAGATCAGCCTGG - Intronic
1064303846 10:14147728-14147750 CAGGAGGTGAGTGGCGGGCAAGG - Intronic
1064388257 10:14918892-14918914 CAAGAAGTAAGTGATGGGCCTGG - Intronic
1065158413 10:22894410-22894432 CAGGATGTGAGTGGTGGGACAGG - Intergenic
1065232560 10:23613273-23613295 CAGCAGGTAAGTGGTGGGCTGGG - Intergenic
1065555564 10:26912274-26912296 AAGGAGGTCACTGGTGACCCTGG + Intergenic
1067274139 10:44819518-44819540 CAGGTAGTAAGTGCAGAGCCAGG - Intergenic
1070672711 10:78389165-78389187 CAGCAGGTAGGTGGGGAGCCAGG - Intergenic
1070755293 10:78988238-78988260 CAGCTGGTAAGTGGTGAGGCTGG - Intergenic
1072189877 10:93070476-93070498 CTGGACATAAGGGGTGAGCCAGG + Intergenic
1072863527 10:99032443-99032465 CAGGGAGTAAGTGGGGATCCTGG - Intronic
1073255928 10:102151332-102151354 CAGGAGTTAAGAGGCCAGCCTGG - Intergenic
1076041035 10:127248817-127248839 CAGGAGGTGAGTGGTGGGCAAGG + Intronic
1076375545 10:129981381-129981403 ATGGAGGTGAGTGGTGAGCCAGG + Intergenic
1077062029 11:621731-621753 CAGGAGGTGAGTGGTGGCCGGGG - Intronic
1077485453 11:2836410-2836432 CAGGAGGTAGAGGGTGAGGCCGG + Intronic
1078973166 11:16438837-16438859 CAGGAGGTAAGGAGCGAGCAAGG - Intronic
1079567671 11:21902731-21902753 CAGGTGGTATGTGCTGAACCGGG - Intergenic
1082660371 11:55902427-55902449 CAGGAGGGAAGTCCAGAGCCTGG + Intergenic
1083174926 11:60943636-60943658 CAGATGGTGAGTGGGGAGCCAGG + Intronic
1083253508 11:61482803-61482825 AAGGAGGTCAGTGCTGGGCCAGG + Exonic
1083863067 11:65436100-65436122 CAGGAGCTCAGGTGTGAGCCCGG + Intergenic
1084862862 11:72032705-72032727 CTTGAGTTATGTGGTGAGCCTGG - Intronic
1085157010 11:74305069-74305091 CAGGAGGTGAGTGGTGGGCAAGG - Intronic
1085324623 11:75597008-75597030 CAACTTGTAAGTGGTGAGCCAGG - Intronic
1085872926 11:80371677-80371699 CAGGTGGCAAGTGGTGTCCCAGG + Intergenic
1088726958 11:112647479-112647501 CAGAAAGTAAGAGGTGAGGCTGG + Intergenic
1089298161 11:117481864-117481886 CAGGAGGCAAATGGGGAGCCTGG - Intronic
1089750597 11:120648544-120648566 CTGGAGCTCAGTGCTGAGCCTGG - Intronic
1089869239 11:121657451-121657473 CAGCAGGTAAGTGATGAGCGAGG - Intergenic
1090396646 11:126423788-126423810 CAGGAGGTGGGTGGGGAGGCTGG + Exonic
1090629343 11:128632758-128632780 GAGGTGGGAAGTGGGGAGCCAGG + Intergenic
1091360586 11:134975951-134975973 CAGCTGGTAAGTGGAGGGCCTGG - Intergenic
1091520737 12:1239281-1239303 CAGGAGGTTCGTGTGGAGCCAGG - Intronic
1091545359 12:1498190-1498212 CAGCATGTTAGTGGTGAGACTGG + Intergenic
1092194665 12:6541984-6542006 CAGGGGATGAGGGGTGAGCCGGG - Intronic
1093771744 12:23026027-23026049 CAAGTAGTAAGTGGTGAGCTGGG + Intergenic
1093991371 12:25592794-25592816 CAGCTGGTAAGTGGGTAGCCTGG + Intronic
1094617477 12:32048822-32048844 CAGGAGGTGAGTGGTGGGCGAGG + Intergenic
1094668693 12:32547459-32547481 GAGGTGGTAAGTGGTTAGGCTGG - Intronic
1095271345 12:40223689-40223711 CAGGTGGGAAGTTGAGAGCCAGG - Intronic
1095329251 12:40937952-40937974 CAGTAGGTCTGGGGTGAGCCTGG - Intronic
1096638655 12:52977023-52977045 CAGGAGGTCAGGGGTGAGGGGGG - Intergenic
1097488213 12:60232748-60232770 CAGGAGGTCAGTGGTGGGCAAGG + Intergenic
1098400906 12:70074673-70074695 CAGGAAGGAAATGGTGAGGCAGG + Intergenic
1098477770 12:70925159-70925181 CAGTTGGTAAGTGGTGAAGCTGG + Intergenic
1098831428 12:75368483-75368505 CAGGAGTTAAGTGATGCCCCAGG + Intronic
1100276855 12:93079542-93079564 AAGGAAGGAAGTGGTGAGCCAGG - Intergenic
1101299956 12:103469055-103469077 CAGGAGGTCAGGTGTGAGCCAGG - Intronic
1101753905 12:107606148-107606170 GAGCTGGTAAGTGGTGAGCCAGG - Intronic
1102047230 12:109837065-109837087 CAGGAGCTACGTGGAGAGCAAGG - Intergenic
1102538990 12:113604898-113604920 CAGCTGGTAAGTGATGAGGCTGG + Intergenic
1102950450 12:117027499-117027521 CAGGAGGTTAGTGGTGGGGCCGG + Exonic
1103206455 12:119133077-119133099 CAGCTGGTAAGTGCAGAGCCAGG - Intronic
1103743186 12:123105124-123105146 AAGGAGGTGAGGAGTGAGCCAGG - Intronic
1104057795 12:125243936-125243958 AAGGAGGTTAGTGGTGGGCAGGG - Intronic
1104107927 12:125680829-125680851 CAGGAGGTGAGGGAGGAGCCAGG - Intergenic
1105760208 13:23507222-23507244 CAGGAGGCGAGTGGTGGGCAAGG + Intergenic
1107990226 13:45813083-45813105 CAGTGGGAACGTGGTGAGCCTGG + Intronic
1108063417 13:46553917-46553939 CAGGAGGGCAGGGGTGCGCCGGG + Intronic
1108097673 13:46921164-46921186 CAAGAGATAAGTGGTGGGCAAGG + Intergenic
1108125846 13:47241627-47241649 CAGGAGGTGAGTGGTGTGGTGGG - Intergenic
1110554063 13:76838777-76838799 TATGAGGTAAGAGGTAAGCCTGG - Intergenic
1111184862 13:84720432-84720454 CAGGAGGTGGATGGGGAGCCAGG - Intergenic
1113063552 13:106351013-106351035 CATGAGGTTTGTGGTGAGCTAGG - Intergenic
1113698709 13:112366803-112366825 CAGAAGTCAAGTGGGGAGCCTGG + Intergenic
1118857602 14:69636319-69636341 CAGGAGGTAAGCCATCAGCCAGG - Intronic
1119193493 14:72700664-72700686 CAGCAGGTAAGTGGGCAGGCTGG + Intronic
1119431479 14:74570747-74570769 CAGCAGGGAAGTGCTGGGCCAGG + Intronic
1120668089 14:87331126-87331148 CAGCTGGCAAGTGGTGAACCTGG + Intergenic
1122074128 14:99224764-99224786 GAGGAAGTAAGTGGCTAGCCTGG + Intronic
1123092494 14:105748002-105748024 CAGGAAGTAAGTGGTGCCGCCGG - Intergenic
1123098057 14:105775703-105775725 CAGGAAGTAAGTGGTGCCGCCGG - Intergenic
1123694780 15:22870963-22870985 CAGGTGGTAAGGGGGAAGCCAGG + Intronic
1124361988 15:29044315-29044337 CAGGAGGCGAGTGGTGAGCACGG + Intronic
1124411002 15:29436929-29436951 CAGGAGGTTAGGGGTCAGCATGG - Intronic
1124911302 15:33923735-33923757 CAGGAGGTAAGTGGCAAGGCAGG + Intronic
1125434095 15:39627212-39627234 CAGCAGGCAAGTGCTCAGCCCGG - Intronic
1126351691 15:47750949-47750971 CAAGAGTTACTTGGTGAGCCTGG + Intronic
1127006140 15:54572054-54572076 CAAAAGGTAAGTGGTCTGCCTGG - Intronic
1127678855 15:61273131-61273153 GAGGAGGGAAGAGGTGAGTCTGG - Intergenic
1127799720 15:62467301-62467323 GAAGTGCTAAGTGGTGAGCCTGG + Intronic
1128585532 15:68846339-68846361 CAGGAAGTACAAGGTGAGCCTGG + Intronic
1130012635 15:80163467-80163489 CAGGAAGTGAGAGGAGAGCCGGG + Intronic
1130217171 15:81983338-81983360 AAGGAGGTAAGGGGAGAGCTTGG + Intergenic
1130517395 15:84636544-84636566 CAGGAGTTCAGAGATGAGCCTGG + Intergenic
1130862163 15:87900805-87900827 CAGAAGGCCAGGGGTGAGCCAGG - Intronic
1132739945 16:1406927-1406949 CAGGAGTTAAGAGATCAGCCTGG + Intronic
1132853155 16:2033736-2033758 CAGGAAGTGTGTGCTGAGCCAGG + Intronic
1133200353 16:4200430-4200452 CAGGAGGTGGGAGGTGAGCCTGG + Intronic
1133281348 16:4667164-4667186 CTGGAGGTGGGTGGAGAGCCTGG - Intronic
1133758693 16:8781276-8781298 CAGGAGGTAGGTGAGGAGCGTGG - Intronic
1134215062 16:12310981-12311003 AAGGAGGTAAGTGATGAGATGGG + Intronic
1134833960 16:17346174-17346196 CAGCAGCTAAGTGGTGAGCCAGG + Intronic
1135227329 16:20672353-20672375 CAGGAGATTAGTTGTGAACCTGG + Intronic
1135432398 16:22396683-22396705 CAGCTAGTAAGTGGAGAGCCAGG - Intronic
1135932513 16:26750375-26750397 CAGGAGGTAGGAGCTGAGACAGG + Intergenic
1135997449 16:27262032-27262054 CAGGAGTTAAGAGGCTAGCCTGG + Intronic
1136775048 16:32867432-32867454 CAGGAGGTTAGGTGTGAGTCTGG + Intergenic
1136895570 16:33994080-33994102 CAGGAGGTTAGGTGTGAGTCTGG - Intergenic
1137408220 16:48206765-48206787 CAGCAGGTAAGGGGTGAGCCAGG - Intronic
1137897668 16:52231811-52231833 CAGGTAATAAGTGGTGAGCTGGG - Intergenic
1138447962 16:57076656-57076678 CAGGTGGGGAGTGGTGAGCAAGG - Intronic
1138628038 16:58268093-58268115 CAGGATGTAAGTGTACAGCCTGG - Intronic
1139149770 16:64367724-64367746 CATGAGGGAAGTGCTGGGCCAGG + Intergenic
1139314402 16:66056155-66056177 CGGGAGGTCAGTGATCAGCCAGG + Intergenic
1140219053 16:73030448-73030470 GAGGATGTAATTGGTGAGGCAGG + Intronic
1140226613 16:73082674-73082696 CACGAGGGAAGTGGTGTGCCTGG + Intergenic
1140725532 16:77808085-77808107 CAGGAGGTAATTGGTGGGCAAGG + Intronic
1141043630 16:80694272-80694294 CAGGAGGTGAGTGGTGGGTAAGG - Intronic
1141054887 16:80804886-80804908 GAGGAGGTAGGTGGGGACCCCGG - Intergenic
1141322958 16:83028954-83028976 CAGGTTGTAAATGATGAGCCAGG - Intronic
1141814519 16:86400593-86400615 CATGGGGAAATTGGTGAGCCAGG - Intergenic
1142103772 16:88291146-88291168 CAAGAGGGGAGTGGGGAGCCCGG - Intergenic
1142380486 16:89729313-89729335 AAGGAAGTAAGTGGGCAGCCCGG + Exonic
1203077466 16_KI270728v1_random:1129541-1129563 CAGGAGGTTAGGTGTGAGTCTGG + Intergenic
1142457569 17:64955-64977 CAGGAGGCAGGAGGTGGGCCTGG + Intergenic
1143281357 17:5756989-5757011 GAGCAGGAAAGTGGAGAGCCAGG - Intergenic
1143374832 17:6461356-6461378 CAGGAGGTGAGTGGCCATCCTGG - Exonic
1143551405 17:7632609-7632631 CAGGATTTAAGTGGTGAGAATGG + Intronic
1143728867 17:8868560-8868582 CAGGAGGAAAGTGGAGTGCCAGG + Intergenic
1144654791 17:17028643-17028665 CAGGCAGTATGTGGTGGGCCTGG - Intergenic
1144823014 17:18088550-18088572 CAGAAGGTACGTGGTGGACCTGG - Intronic
1145840429 17:27989688-27989710 CAGAAGGCAAGTGGTTGGCCTGG - Intergenic
1146022470 17:29292360-29292382 CAGAAGGTAAGTGCTGGGTCGGG + Intronic
1146623960 17:34421893-34421915 CAGGAAGTAAGCGGTGAAACTGG - Intergenic
1147194053 17:38753307-38753329 CTGGACGTCAGTGGCGAGCCCGG - Exonic
1148106152 17:45120113-45120135 CAGGAAGGGAGTGGGGAGCCGGG - Intronic
1148795679 17:50195601-50195623 CAGGGTGTGCGTGGTGAGCCTGG - Exonic
1148975269 17:51522127-51522149 CTGGAGGTCATTGGTGACCCAGG + Intergenic
1149076526 17:52602047-52602069 CAGGAGGTGAGTGGCAGGCCAGG - Intergenic
1149525072 17:57349110-57349132 CAGAAGACAAGTGGTCAGCCAGG - Intronic
1149979656 17:61299694-61299716 CAGCAAGTGAGTGATGAGCCAGG + Intronic
1150131200 17:62670191-62670213 CAGGACTTAAGTGATGAGACCGG - Intronic
1150474528 17:65464699-65464721 CAGGAAGGAAATGGTGAGGCCGG - Intergenic
1151429952 17:74055690-74055712 CAGCAGGTCTGGGGTGAGCCTGG + Intergenic
1151573699 17:74940522-74940544 CAGGAGGTAAGTGATGGGGAGGG + Intronic
1152405661 17:80096567-80096589 CAGGAGGTGAGGGGTGGGCATGG - Intronic
1152437181 17:80283588-80283610 CAGGAGGGGAGTGGCCAGCCAGG - Intronic
1152892799 17:82892019-82892041 CAGGGGGGAAGTGGGGGGCCTGG - Intronic
1153246988 18:3082169-3082191 CAGGAGGTGAGTGGTGGGCGAGG - Intronic
1153975301 18:10263707-10263729 CAGGAGGTAACTGATCAGCCTGG + Intergenic
1154394433 18:13974279-13974301 GAGGAGGTATGTGAAGAGCCTGG - Intergenic
1154491380 18:14924898-14924920 CAGCTGGAAAGTGGTTAGCCAGG - Intergenic
1155833316 18:30545462-30545484 CAGGAGGTGAGTTTTAAGCCAGG - Intergenic
1156365854 18:36426325-36426347 CAGCTGGTAATTGGTGAACCTGG + Intronic
1157468535 18:47969333-47969355 CAGGAGGTGAGCGGTGGGCGAGG + Intergenic
1157709637 18:49841348-49841370 GATGAGGTGAGTGGGGAGCCAGG - Exonic
1158142208 18:54267850-54267872 CAGGAGGTGAGTAGCGGGCCCGG + Intergenic
1158296071 18:55998074-55998096 CAGAAGGTAATTGAGGAGCCGGG + Intergenic
1159537588 18:69735172-69735194 CTGGATGCAAGTGGTGAGGCTGG + Intronic
1159927523 18:74282310-74282332 CAGGATGGAAGAGGAGAGCCTGG - Intronic
1161284553 19:3462637-3462659 CAGGAGGTGGGGGGTGAGCGTGG + Intronic
1161286410 19:3470813-3470835 GAGGAGGTAAGTGATGAGTAGGG + Intergenic
1161718327 19:5889958-5889980 AAGGAGGTGAGGGGTGAGCTTGG + Intronic
1161801371 19:6418271-6418293 CAGAAGGTCAGAGGTGAGGCCGG + Intronic
1162655502 19:12126077-12126099 GCGGAGGTAAGCAGTGAGCCAGG - Intronic
1162960461 19:14122746-14122768 CTGGAGGAGTGTGGTGAGCCGGG + Intronic
1163597803 19:18230668-18230690 CAGGAGGAAAGAGGTCAGCTAGG - Intronic
1164480471 19:28607710-28607732 CACAAGGTAACTGGTAAGCCAGG + Intergenic
1164527024 19:29020053-29020075 CCTGAGGTAAGTGGTCAGGCAGG + Intergenic
1164998768 19:32743584-32743606 CAGGAGGAAAGATGTGGGCCTGG - Intronic
1165601574 19:37059026-37059048 CGGGAGGCATGTGGTGAGGCAGG - Intronic
1166148303 19:40852053-40852075 CAGGAGGTGAGTGCTGGGACTGG + Intronic
1166152445 19:40883838-40883860 CAGGAGGTGAGTGCTGAGACTGG + Intronic
1166171322 19:41029362-41029384 CAGGAGGTGAGTGCTGAGACTGG + Intergenic
1166177735 19:41086807-41086829 CAGGAGGTGAGTGCTGGGACTGG - Intergenic
1167550779 19:50159324-50159346 GAGCAGGTAAGGGGTGAGGCTGG + Intronic
1168111165 19:54191952-54191974 CAGGAGGAAGCTGGTGAGCATGG + Exonic
925144755 2:1573719-1573741 CAGAAGGCAAGCTGTGAGCCCGG + Intergenic
926217485 2:10914301-10914323 CAGGAGGTAGGTGTGCAGCCGGG + Intergenic
926491648 2:13532220-13532242 CAGAAGGTAACCGGTAAGCCAGG - Intergenic
926954653 2:18281208-18281230 TGGGAGGTAAGAGGTGAGACTGG - Intronic
927864690 2:26580889-26580911 CAGAAGGGGAGTGGGGAGCCGGG + Intergenic
927989277 2:27435943-27435965 CAGGAGGTAAGTGGCCAGCCAGG - Intronic
928243279 2:29605295-29605317 CAGGAGGTGAGTAGCGAGCAAGG - Intronic
929584986 2:43107880-43107902 CAGCTAGTAAGTGGTGAGCCAGG - Intergenic
929818368 2:45254353-45254375 CAGGAAATAAGTGCAGAGCCAGG + Intergenic
929824952 2:45302768-45302790 CAGGTGGGAAGGGTTGAGCCGGG - Intergenic
930517953 2:52431971-52431993 CACAAGGTAACTGGTAAGCCAGG + Intergenic
930747967 2:54904219-54904241 CACAAGGGAAGTGGTGAGCAGGG + Intronic
930762089 2:55049235-55049257 CAGGAGGTGAGGAGGGAGCCCGG + Intronic
931385556 2:61794871-61794893 CAGGAGTTAAGAGGCCAGCCTGG + Intergenic
932158190 2:69437344-69437366 CAGGCGGTAGGTGACGAGCCTGG - Exonic
933678095 2:85075865-85075887 CAGGAGGCGTGAGGTGAGCCTGG - Intergenic
933774905 2:85766008-85766030 CAGCTGGTGAGTGGTGAGCCAGG - Intronic
933936024 2:87204400-87204422 CACAAGGTAACTGGTAAGCCAGG - Intergenic
934565518 2:95338117-95338139 CAGGAGGTAGGTGGGGAGGCAGG + Intronic
934634343 2:95969149-95969171 CAGGAGGTGAGGGGTGGGGCTGG + Intronic
934799289 2:97136090-97136112 CAGGAGGTGAGGGGTGGGGCTGG - Intronic
934834152 2:97567379-97567401 CAGGAGGTGAGGGGTGGGGCTGG + Intronic
934851101 2:97701766-97701788 CAGGAGGTCAGTGGGAAGCTCGG - Intergenic
935566936 2:104619026-104619048 CAGGAGGCAACTGGTGTGCTGGG - Intergenic
935682187 2:105647694-105647716 CAGCAGGTCAGTGGGGAGGCTGG - Intergenic
936284852 2:111174004-111174026 CAGGAGGTCAGGGGCGAGCCTGG - Intergenic
936357124 2:111761429-111761451 CACAAGGTAACTGGTAAGCCAGG + Intergenic
937029892 2:118730262-118730284 GAGGAAGTAAATGGTGAGCTTGG - Intergenic
937975208 2:127578074-127578096 CAGGAGGGAGGTGGTGGGGCAGG + Intronic
939246929 2:139636992-139637014 CAGGAGGTGAGTGGTGGGTGAGG + Intergenic
940906605 2:159175248-159175270 CAGAAGGCAGGTGGTCAGCCGGG + Intronic
941621965 2:167788647-167788669 CAGGAGGTGAGTGGTGGGCAAGG - Intergenic
943657770 2:190527710-190527732 CAGGAGGTGAGCGGTGCGCGAGG + Intronic
945019590 2:205557549-205557571 CAGGTGGTAAGTGATGAAACTGG - Intronic
945157336 2:206853222-206853244 CAGGAGGTGAGCGGGGAGCAGGG + Intergenic
945197535 2:207251317-207251339 CAGCTAGTAAGTGATGAGCCGGG + Intergenic
946764952 2:223031902-223031924 CAGGAGGCTAGGTGTGAGCCTGG + Intergenic
947227443 2:227853820-227853842 AAGGGGATAAGTGCTGAGCCAGG - Intergenic
947754487 2:232551544-232551566 CAGATGGTAAGTGGTGAATCTGG - Intronic
947847103 2:233253309-233253331 CAGCAGGTTAATGGTGAGACTGG + Intronic
948046426 2:234949164-234949186 CAGCAGGTGAGTGGTGGGTCTGG + Intergenic
948612605 2:239179346-239179368 CAGGAGGTAAGTGGCAGGCTAGG + Intronic
1172892938 20:38279802-38279824 GAGGAGGTAAGTGCTGAGGGGGG + Intronic
1173302865 20:41819168-41819190 CAGGAGGTCAGAGGTGTGACAGG - Intergenic
1173573906 20:44097679-44097701 CAGGTGGGCAGTGGGGAGCCCGG - Intergenic
1173748120 20:45453542-45453564 TAGGAGGTAGGTGGTGGGCAGGG + Intergenic
1173819410 20:46010962-46010984 CAGGAGGAAAGGCGTGTGCCAGG - Exonic
1174037720 20:47678528-47678550 CAGCAGGTAAGTGGTTGGCATGG + Intronic
1174377680 20:50137239-50137261 CAGGAGTTCACTGGTCAGCCTGG - Intronic
1175237236 20:57523686-57523708 CAGTAAGTTAGCGGTGAGCCTGG - Exonic
1175253773 20:57625872-57625894 CAGGAGGTAAGGGAAGGGCCAGG + Intergenic
1175606730 20:60317362-60317384 CAGCAGGCATGAGGTGAGCCTGG + Intergenic
1175912086 20:62409877-62409899 CAGGACTTTAGAGGTGAGCCTGG - Intergenic
1176049347 20:63108417-63108439 CAGGAGGTGAGAGGTCAGTCTGG - Intergenic
1176078511 20:63260124-63260146 GAGGAGGCAGGTGCTGAGCCAGG - Intronic
1178619071 21:34158562-34158584 CTGGAGGGAAGTGGAGTGCCTGG + Intergenic
1179136368 21:38683521-38683543 ATGGAGGTGAGTGGTGAGACAGG + Intergenic
1179248347 21:39652192-39652214 CTGGATGTGAGTGGTGAGCCAGG + Intronic
1179418186 21:41215085-41215107 CGGGAGGTCACTGGTGAGCTTGG + Intronic
1179598548 21:42460411-42460433 CAGGAGGGAAGTGGAGAACTGGG - Intergenic
1180927960 22:19569163-19569185 CTGGTGGTAAGTGTTCAGCCAGG + Intergenic
1182005831 22:26958799-26958821 CAGGAGGGAAGTGTGGACCCAGG + Intergenic
1182208147 22:28649205-28649227 CAGGAGGTAGGAGGTGGGACAGG + Intronic
1182428242 22:30286080-30286102 CAGGAGGTCACTGGGGAACCTGG + Exonic
1182467090 22:30524138-30524160 CAGGAAGGAACTGGTGAGGCAGG - Exonic
1183363500 22:37395218-37395240 CAGCTGGTAAGTGGTGAGGCTGG + Intronic
1183986906 22:41575098-41575120 CAGGAGGTAGGTGGAGGGCAAGG + Exonic
1184245253 22:43232513-43232535 CAAAAGGTAAGTGGGGAGCTGGG + Intronic
1184763309 22:46557891-46557913 CTGGAGGGAAGAGGTGCGCCCGG + Intergenic
1185369708 22:50455423-50455445 CAGGAGGTCAGCGAGGAGCCCGG + Intronic
949962302 3:9322501-9322523 CAGGAGGTGAGTGGTGGGCAAGG + Intronic
950105961 3:10388641-10388663 CAGGTAGTAGGTGGTGGGCCTGG - Intronic
950109169 3:10407545-10407567 CAGGAGTTAAGGCCTGAGCCAGG - Intronic
950438850 3:12995550-12995572 CAGCAGCTAAGGGGTGAGCTGGG + Intronic
950742945 3:15064479-15064501 CAGCCGGTGAGCGGTGAGCCGGG - Intronic
954106609 3:48412919-48412941 CAGGAGGTCACTGGTGAGATCGG + Exonic
954796687 3:53165072-53165094 CAGGAGGAAACAGCTGAGCCGGG - Intronic
955117213 3:56017596-56017618 AAGAAAGTGAGTGGTGAGCCAGG - Intronic
955690932 3:61590031-61590053 CACGTGGTAAGTGGTGACTCAGG + Intronic
955733147 3:62008864-62008886 CAGGAGGTGAGTGGTGGGCAAGG - Intronic
956668226 3:71661924-71661946 TAGCTGGAAAGTGGTGAGCCAGG - Intergenic
956808558 3:72841891-72841913 CAGGAGGTGAGCGGAGGGCCAGG - Intronic
957021939 3:75137437-75137459 CAGAAGGTAACTGGTAAGCCAGG + Intergenic
957024481 3:75165990-75166012 CAGGAGGAAAGAGGAGAGACAGG + Intergenic
959375574 3:105584673-105584695 TAGGAGGTAACTGTTGAGACAGG - Intergenic
960141323 3:114154396-114154418 CAGGAGGAAAGAGGCCAGCCTGG + Intronic
962087674 3:132208984-132209006 CAGGAGGTGAGTGGTGAGTGAGG + Intronic
963080312 3:141385942-141385964 CAGGAGGTCAGTGCTGACACTGG - Intronic
964172640 3:153789399-153789421 CAGGAGGTAAGTGGTTATGGAGG - Intergenic
964218931 3:154322478-154322500 CTGGAGGTAAGTGGTTAGATTGG + Intronic
965398253 3:168186910-168186932 CAGGAGAGAAGTGGGGAGTCAGG + Intergenic
965698221 3:171431838-171431860 CAGGATGTAAGTTGCCAGCCTGG - Intronic
966144133 3:176790666-176790688 CAGCTAGTAAGTGGTGAACCAGG - Intergenic
966297986 3:178445805-178445827 CAGGAGGGAAGGTCTGAGCCTGG + Intronic
967815292 3:193793060-193793082 CAGCTAGTAAGTGGTGAGGCTGG - Intergenic
969243242 4:5915810-5915832 CAGGAGGTAAGTTCAGTGCCTGG + Intronic
969300790 4:6295752-6295774 CAGGAGGAAAGCGGGGAGCGGGG + Intronic
970260389 4:14218279-14218301 CTGGAGATAAGTGATGAACCAGG - Intergenic
971009393 4:22416433-22416455 CAGCTGCTAAGTGGTGAGGCTGG - Intronic
972286680 4:37655844-37655866 GAAGAGGTAAGTGGTCAGCTGGG + Intronic
972339601 4:38140019-38140041 CAGGTGTTTAGTGGTGTGCCTGG + Intergenic
972959156 4:44430739-44430761 CAGGAGGGAAATAGTGAGTCTGG - Intronic
974392454 4:61289816-61289838 CAGCTTGTAAGTAGTGAGCCAGG - Intronic
976222806 4:82771663-82771685 CAGGAGGCAGGTGGAGAGGCAGG - Intronic
979329283 4:119408278-119408300 CAGGAGGCAAGAGCTGTGCCTGG + Intergenic
979943655 4:126796467-126796489 CAGGAGGTAAGTGTTGAATAGGG - Intergenic
980021137 4:127711582-127711604 CAGGAGGTGAGTGGCGGGCCAGG + Intronic
980041474 4:127945532-127945554 CAGGAGTTAAGAGATCAGCCTGG - Intronic
980043145 4:127962625-127962647 CTGGAGTGCAGTGGTGAGCCTGG - Intronic
980981550 4:139658574-139658596 CAGAAGGGAAGAGGTGAGGCTGG - Intergenic
982215653 4:153080708-153080730 CAGGAGGGGAGTGGTGAGGGTGG - Intergenic
982404485 4:155004660-155004682 CAGGAGGTAAGAAGAGAGGCTGG + Intergenic
984924102 4:184791607-184791629 CAGCAGGGAAGTGGTGAGGATGG + Intronic
986351987 5:6888868-6888890 CAGGAGGGAACAGGTGAGGCAGG + Intergenic
987167693 5:15218593-15218615 CAGGAGGTAAGGATGGAGCCAGG + Intergenic
987481496 5:18464473-18464495 CAGGAGTTAAGAGGCCAGCCTGG - Intergenic
991457248 5:66817070-66817092 AAGGAGATAAGTGGAGACCCAGG - Intronic
992107288 5:73460352-73460374 CAGTAGGTCTGTGGTGAGCCTGG - Intergenic
993176001 5:84486564-84486586 CAGGAGATGAGTGGTGGGCATGG - Intergenic
993328362 5:86568444-86568466 CACAAGGTAACTGGTAAGCCAGG - Intergenic
993648659 5:90490953-90490975 CAGGTGGTAAGTGATGCACCTGG - Intronic
993662695 5:90658273-90658295 CCAGAGGTAAGTAGTGAGCTTGG + Exonic
997413374 5:133707139-133707161 CAGCAGGGAAGAGGTGAGTCAGG - Intergenic
997959444 5:138308089-138308111 TAGGAAGTAAGAGGTGGGCCAGG - Intronic
999357288 5:150947170-150947192 AAAGAGGGAAGTGGGGAGCCTGG + Intergenic
999813887 5:155156091-155156113 CAGCTGGTAAGTAGGGAGCCAGG + Intergenic
999838124 5:155396440-155396462 AAGGAAGTAAGTTTTGAGCCAGG + Intergenic
999911232 5:156202188-156202210 GAGGAGTTAAGTGGTGAGTGGGG - Intronic
1000621246 5:163489234-163489256 CAGGAGGTAAGTGGTGAGCCAGG - Intronic
1000912346 5:167037672-167037694 AAGGAGGTAAGTGGTCATCTTGG - Intergenic
1000924870 5:167180892-167180914 GAGGAGGTAAAAGGGGAGCCAGG + Intergenic
1006507553 6:34499327-34499349 CAGGAGGTAAGTGGTGAGCAAGG - Intronic
1007281243 6:40713890-40713912 CAGGAGGGAAGGGGTGAGCTGGG + Intergenic
1008459942 6:51757072-51757094 CAGGAAGTGAGTGGTGGGCAAGG - Intronic
1009354024 6:62717905-62717927 TAAGAGATAAGTGGTGGGCCGGG + Intergenic
1009972413 6:70638775-70638797 CAGAAAGTAAGCGGTGAGCCAGG - Intergenic
1012612253 6:101230651-101230673 CACAAGGTAACTGGTGAGCCAGG - Intergenic
1013016285 6:106163501-106163523 CTGGAGGAAAGGAGTGAGCCAGG - Intergenic
1013367620 6:109447443-109447465 AAGGAGGTAAGTGCTCAGGCAGG + Intronic
1014477619 6:121892746-121892768 AAGGAAGTAAGTAGTGAGGCAGG - Intergenic
1014547980 6:122754791-122754813 TAAGAGATAGGTGGTGAGCCAGG - Intergenic
1014802377 6:125791062-125791084 CTGTAGGTAGGTGGTGAGGCGGG + Exonic
1016447308 6:144147295-144147317 ATGGAGGTCAGTGGTGAGCTTGG - Intergenic
1016783464 6:147985632-147985654 CTGGAGGGAAGTGGAGGGCCAGG + Intergenic
1017230655 6:152069774-152069796 CAAGAGGTGAGTGGTGGGCAAGG - Intronic
1017736379 6:157368787-157368809 CAGGAGGCCAGTGGGGAGTCTGG - Intergenic
1017862144 6:158408695-158408717 CGGGAGGTCAGTGGTGAGGAAGG - Intronic
1018148218 6:160913117-160913139 CAGGCTGTAGGTGGTGAGACTGG - Intergenic
1019554622 7:1622716-1622738 TAGCAGGTAGATGGTGAGCCTGG - Intergenic
1020079002 7:5276536-5276558 CAGCTGGTGAGTGGTGAGGCGGG - Intronic
1020611732 7:10405632-10405654 CAGGAGGTAAGTAGAAAACCAGG - Intergenic
1020965014 7:14854644-14854666 CAGGAGGTGAGCAGTGGGCCAGG - Intronic
1022253377 7:28630995-28631017 CAGCAAGTAAGTGGTTAGGCTGG + Intronic
1023583821 7:41708332-41708354 CAGGAGCTAAGTGATGAACCAGG - Intergenic
1023668661 7:42553264-42553286 CAGGAGGTGAGTGGTGGGTGAGG - Intergenic
1023763322 7:43487513-43487535 CATGTGGTAAGGGGTGAGCGAGG - Intronic
1024073973 7:45809327-45809349 CAGGAGGCAAGAGCTGTGCCTGG - Intergenic
1024557450 7:50615613-50615635 CAGATGGTAAGTGCTCAGCCAGG + Intronic
1024649358 7:51390871-51390893 CAGGAGGCAAGAGCTGTGCCTGG + Intergenic
1024948124 7:54832839-54832861 CAAGAGGGAAGTGGTGGGGCAGG - Intergenic
1025053437 7:55746200-55746222 CAGGAGGCAAGAGCTGTGCCTGG + Intergenic
1025131540 7:56376674-56376696 CAGGAGGCAAGAGCTGTGCCTGG + Intergenic
1025182341 7:56829740-56829762 CAGGAGGCAAGAGCTGTGCCTGG + Intergenic
1025199893 7:56955642-56955664 CAGCTGGTGAGTGGTGAGGCAGG + Intergenic
1025672053 7:63621290-63621312 CAGCTGGTGAGTGGTGAGGCAGG - Intergenic
1025689586 7:63747254-63747276 CAGGAGGCAAGAGCTGTGCCTGG - Intergenic
1026462262 7:70624961-70624983 GAGGAGGAAACTGGTGAGCTGGG - Intronic
1026539348 7:71266795-71266817 CATGAGGGAAGAGGAGAGCCTGG + Intronic
1028447058 7:90936722-90936744 CAGGAAGTAAGTGGTAAATCAGG - Intronic
1031377163 7:121041605-121041627 AAGGAGGTCATTTGTGAGCCAGG + Intronic
1031550411 7:123104915-123104937 CAAGAGGTAAGTGGTGAAGCAGG + Intergenic
1031808926 7:126341408-126341430 AAGGAGGTAAGAGATGAGCTAGG - Intergenic
1037472483 8:19224306-19224328 CAGGAGATAACTGGTGACCCAGG + Intergenic
1037846959 8:22292013-22292035 AAAGAGGTAAGAGGTTAGCCAGG + Intronic
1038338568 8:26664726-26664748 CAGGAGGAAGCTGGTGAGCAGGG - Intergenic
1038776960 8:30540005-30540027 CAGGAGGTAACTGCTGTGACTGG + Intronic
1040040909 8:42916034-42916056 CAGGAGATATTTGGTGGGCCTGG - Intronic
1040602697 8:48899673-48899695 CATGAGGAAATTGGGGAGCCTGG - Intergenic
1040683461 8:49842046-49842068 CAGGATGGGAGTGGTGAGACAGG - Intergenic
1041945837 8:63441796-63441818 CAGAGGGTAAGTGGTGTGACAGG + Intergenic
1042876051 8:73440852-73440874 CACGAGGTAGGTAATGAGCCTGG - Intronic
1043698416 8:83251565-83251587 CAGGAGCTACGTCGTGGGCCCGG + Intergenic
1044586780 8:93875859-93875881 CAGGAGGTGAGCAGTGGGCCAGG - Intronic
1046171758 8:110517339-110517361 CAGATGGTAAGTGGTGAGCTTGG - Intergenic
1046765212 8:118061605-118061627 CTGGAGGTAAGTGGTAAAACTGG + Intronic
1047995350 8:130329932-130329954 CAGGAGGGAAATGGTGATTCAGG - Intronic
1048148301 8:131867479-131867501 AGGGAGGAAGGTGGTGAGCCAGG - Intergenic
1048439267 8:134447924-134447946 CAGGAGGGAAGAGATGAGTCAGG + Intergenic
1048453332 8:134553846-134553868 CAGGCAGTAAGTGGGAAGCCAGG + Intronic
1049165135 8:141120982-141121004 CAGGCTGTAGGTGCTGAGCCAGG + Intronic
1049197165 8:141322248-141322270 CAGGAGTTGAGTGGGGAGCAGGG - Intergenic
1049197942 8:141325676-141325698 CAGGAGGTAAGGGGCGGGCAGGG + Intergenic
1049355620 8:142186756-142186778 CAGGAGGTGGGTAGGGAGCCAGG - Intergenic
1050205067 9:3187510-3187532 CAGGCGGTAAGAGGTGGGGCTGG - Intergenic
1050588756 9:7140987-7141009 GAGGAGGTAAATCATGAGCCTGG + Intergenic
1052638610 9:31134707-31134729 CAGTAGGTAAGAGCTGAGCGTGG + Intergenic
1055539757 9:77291098-77291120 CAGGAGTTGAGTGGTGGGCGAGG + Intronic
1056580554 9:87886056-87886078 CAGGGGGTGAGAGGTGGGCCTGG - Exonic
1056588377 9:87944265-87944287 CAGGAGCTACGTGATGATCCTGG + Intergenic
1057501540 9:95600672-95600694 CAGGGGGTAAGGCGTGAACCAGG + Intergenic
1057858325 9:98619924-98619946 CAGCAGGTGAGTGGTGAGCTGGG - Intronic
1058115069 9:101076137-101076159 CAGGAGGTCTGGGGTGGGCCTGG - Intronic
1058144817 9:101399264-101399286 CAGGAGGTTGGTGGGGGGCCTGG - Intronic
1058714492 9:107711514-107711536 CAGTTGGTAAGTGGTAGGCCTGG + Intergenic
1060205777 9:121682063-121682085 GGGAAGGTCAGTGGTGAGCCTGG + Intronic
1060472688 9:123961649-123961671 CAGAAGGAAAGTAGTGTGCCAGG - Intergenic
1060661258 9:125406537-125406559 CAGCAGGTAAGACGAGAGCCCGG - Intergenic
1060807298 9:126585809-126585831 CAGGGGGTAGGTGGTGAGCCAGG + Intergenic
1061205660 9:129161705-129161727 CAGGAGGGAGGTGGTGTGGCTGG + Intergenic
1061425634 9:130496695-130496717 CAGGAGGGCCCTGGTGAGCCAGG + Intronic
1061433116 9:130543668-130543690 CAGGAAGTAAGAGGAGAGACTGG + Intergenic
1061864819 9:133486721-133486743 GCGGAGGTAAGTTGTGAGCCGGG + Intergenic
1062726895 9:138079356-138079378 CAGGAGGCAGGTGGAGAACCAGG + Intronic
1187275588 X:17814101-17814123 GAGGAGTGAAGTGGTGAGACAGG + Intronic
1187332625 X:18354575-18354597 CTGGAGGTACGTGGTGATTCCGG - Exonic
1187587833 X:20683677-20683699 AAGGAGGTAAGGGGTGAGAGTGG + Intergenic
1189004910 X:36985506-36985528 CAGGAGGTAAGAGGTAGCCCGGG - Intergenic
1189044117 X:37572438-37572460 CAGGAGGTAAGAGGTAGCCCGGG + Exonic
1189563344 X:42213804-42213826 CAGGAGGGAAGTGGAGGGCCTGG + Intergenic
1192554353 X:72078139-72078161 CAGGCTGTAAATGGTGAGGCTGG + Intergenic
1195048679 X:101077890-101077912 CAGCTAGTAAGTGGAGAGCCAGG - Intergenic
1195314762 X:103666545-103666567 CAGAAGGTAAGTGGACAGCAAGG + Intergenic
1196819727 X:119693059-119693081 CAGGTGGTAAGTGCAGAGCTTGG - Exonic
1198944486 X:141995507-141995529 CAGGAGTTCAAGGGTGAGCCTGG + Intergenic
1199814323 X:151384541-151384563 CAGGAGATAGGTGTTGAGGCAGG + Intergenic
1201755286 Y:17480524-17480546 CAGAAGGTAAGGCCTGAGCCTGG + Intergenic
1201846266 Y:18425461-18425483 CAGAAGGTAAGGCCTGAGCCTGG - Intergenic
1202586164 Y:26430295-26430317 CAGGAGGTGAGGGGTGGGGCTGG - Intergenic