ID: 1000621250

View in Genome Browser
Species Human (GRCh38)
Location 5:163489250-163489272
Sequence GAACCCGGCTGCAGAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2493
Summary {0: 1, 1: 31, 2: 293, 3: 761, 4: 1407}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000621250_1000621255 -5 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621255 5:163489268-163489290 GGTTCCTAACAGGCCTTGGATGG 0: 1
1: 14
2: 31
3: 66
4: 165
1000621250_1000621263 22 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621263 5:163489295-163489317 TGGTCTGTAGCCCGGAGGTTGGG 0: 1
1: 0
2: 21
3: 151
4: 427
1000621250_1000621253 -9 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621253 5:163489264-163489286 GCCGGGTTCCTAACAGGCCTTGG 0: 1
1: 14
2: 402
3: 771
4: 906
1000621250_1000621258 2 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621258 5:163489275-163489297 AACAGGCCTTGGATGGGTATTGG 0: 1
1: 0
2: 7
3: 45
4: 301
1000621250_1000621262 21 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621262 5:163489294-163489316 TTGGTCTGTAGCCCGGAGGTTGG No data
1000621250_1000621256 -4 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621256 5:163489269-163489291 GTTCCTAACAGGCCTTGGATGGG 0: 1
1: 23
2: 218
3: 469
4: 720
1000621250_1000621261 17 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621261 5:163489290-163489312 GGTATTGGTCTGTAGCCCGGAGG 0: 1
1: 0
2: 10
3: 97
4: 287
1000621250_1000621264 23 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621264 5:163489296-163489318 GGTCTGTAGCCCGGAGGTTGGGG 0: 1
1: 1
2: 28
3: 185
4: 627
1000621250_1000621260 14 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000621250 Original CRISPR GAACCCGGCTGCAGAGCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr