ID: 1000621251

View in Genome Browser
Species Human (GRCh38)
Location 5:163489253-163489275
Sequence TAGGAACCCGGCTGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2516
Summary {0: 1, 1: 33, 2: 332, 3: 802, 4: 1348}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000621251_1000621258 -1 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621258 5:163489275-163489297 AACAGGCCTTGGATGGGTATTGG 0: 1
1: 0
2: 7
3: 45
4: 301
1000621251_1000621261 14 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621261 5:163489290-163489312 GGTATTGGTCTGTAGCCCGGAGG 0: 1
1: 0
2: 10
3: 97
4: 287
1000621251_1000621264 20 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621264 5:163489296-163489318 GGTCTGTAGCCCGGAGGTTGGGG 0: 1
1: 1
2: 28
3: 185
4: 627
1000621251_1000621262 18 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621262 5:163489294-163489316 TTGGTCTGTAGCCCGGAGGTTGG No data
1000621251_1000621260 11 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621251_1000621255 -8 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621255 5:163489268-163489290 GGTTCCTAACAGGCCTTGGATGG 0: 1
1: 14
2: 31
3: 66
4: 165
1000621251_1000621263 19 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621263 5:163489295-163489317 TGGTCTGTAGCCCGGAGGTTGGG 0: 1
1: 0
2: 21
3: 151
4: 427
1000621251_1000621256 -7 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621256 5:163489269-163489291 GTTCCTAACAGGCCTTGGATGGG 0: 1
1: 23
2: 218
3: 469
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000621251 Original CRISPR TAGGAACCCGGCTGCAGAGC AGG (reversed) Intronic
Too many off-targets to display for this crispr