ID: 1000621254

View in Genome Browser
Species Human (GRCh38)
Location 5:163489265-163489287
Sequence TCCAAGGCCTGTTAGGAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3321
Summary {0: 4, 1: 217, 2: 628, 3: 1120, 4: 1352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000621254_1000621260 -1 Left 1000621254 5:163489265-163489287 CCGGGTTCCTAACAGGCCTTGGA 0: 4
1: 217
2: 628
3: 1120
4: 1352
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621254_1000621262 6 Left 1000621254 5:163489265-163489287 CCGGGTTCCTAACAGGCCTTGGA 0: 4
1: 217
2: 628
3: 1120
4: 1352
Right 1000621262 5:163489294-163489316 TTGGTCTGTAGCCCGGAGGTTGG No data
1000621254_1000621261 2 Left 1000621254 5:163489265-163489287 CCGGGTTCCTAACAGGCCTTGGA 0: 4
1: 217
2: 628
3: 1120
4: 1352
Right 1000621261 5:163489290-163489312 GGTATTGGTCTGTAGCCCGGAGG 0: 1
1: 0
2: 10
3: 97
4: 287
1000621254_1000621263 7 Left 1000621254 5:163489265-163489287 CCGGGTTCCTAACAGGCCTTGGA 0: 4
1: 217
2: 628
3: 1120
4: 1352
Right 1000621263 5:163489295-163489317 TGGTCTGTAGCCCGGAGGTTGGG 0: 1
1: 0
2: 21
3: 151
4: 427
1000621254_1000621264 8 Left 1000621254 5:163489265-163489287 CCGGGTTCCTAACAGGCCTTGGA 0: 4
1: 217
2: 628
3: 1120
4: 1352
Right 1000621264 5:163489296-163489318 GGTCTGTAGCCCGGAGGTTGGGG 0: 1
1: 1
2: 28
3: 185
4: 627

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000621254 Original CRISPR TCCAAGGCCTGTTAGGAACC CGG (reversed) Intronic
Too many off-targets to display for this crispr