ID: 1000621257

View in Genome Browser
Species Human (GRCh38)
Location 5:163489272-163489294
Sequence ATACCCATCCAAGGCCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 9, 3: 72, 4: 371}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000621257_1000621262 -1 Left 1000621257 5:163489272-163489294 CCTAACAGGCCTTGGATGGGTAT 0: 1
1: 0
2: 9
3: 72
4: 371
Right 1000621262 5:163489294-163489316 TTGGTCTGTAGCCCGGAGGTTGG No data
1000621257_1000621269 26 Left 1000621257 5:163489272-163489294 CCTAACAGGCCTTGGATGGGTAT 0: 1
1: 0
2: 9
3: 72
4: 371
Right 1000621269 5:163489321-163489343 CCCTGCTTTAGAGCACCCTTAGG 0: 1
1: 0
2: 2
3: 18
4: 139
1000621257_1000621264 1 Left 1000621257 5:163489272-163489294 CCTAACAGGCCTTGGATGGGTAT 0: 1
1: 0
2: 9
3: 72
4: 371
Right 1000621264 5:163489296-163489318 GGTCTGTAGCCCGGAGGTTGGGG 0: 1
1: 1
2: 28
3: 185
4: 627
1000621257_1000621260 -8 Left 1000621257 5:163489272-163489294 CCTAACAGGCCTTGGATGGGTAT 0: 1
1: 0
2: 9
3: 72
4: 371
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621257_1000621261 -5 Left 1000621257 5:163489272-163489294 CCTAACAGGCCTTGGATGGGTAT 0: 1
1: 0
2: 9
3: 72
4: 371
Right 1000621261 5:163489290-163489312 GGTATTGGTCTGTAGCCCGGAGG 0: 1
1: 0
2: 10
3: 97
4: 287
1000621257_1000621263 0 Left 1000621257 5:163489272-163489294 CCTAACAGGCCTTGGATGGGTAT 0: 1
1: 0
2: 9
3: 72
4: 371
Right 1000621263 5:163489295-163489317 TGGTCTGTAGCCCGGAGGTTGGG 0: 1
1: 0
2: 21
3: 151
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000621257 Original CRISPR ATACCCATCCAAGGCCTGTT AGG (reversed) Intronic
900722914 1:4189478-4189500 GTACCAGTCCATGGCCTGTTTGG - Intergenic
900997138 1:6128762-6128784 ACACCCATCCAGGGCTTGCTTGG - Intronic
901863989 1:12092021-12092043 GTACCAGTCCATGGCCTGTTAGG - Intronic
902136473 1:14310377-14310399 TTAACCATCCGAGGCCTGCTGGG - Intergenic
903139086 1:21327751-21327773 GTACCAGTCCATGGCCTGTTAGG + Intronic
903450061 1:23447145-23447167 GTACAGGTCCAAGGCCTGTTAGG - Intronic
907064534 1:51467611-51467633 GTACCCATCCATGGCCTGTTAGG + Intronic
907121917 1:52015487-52015509 GTACCTGTCCATGGCCTGTTAGG - Intergenic
907864028 1:58381443-58381465 ATACACGTTAAAGGCCTGTTTGG + Intronic
907911175 1:58828093-58828115 GTACCCATCTGTGGCCTGTTAGG + Intergenic
908664400 1:66474001-66474023 GTACCAGTCCATGGCCTGTTAGG - Intergenic
909423042 1:75487822-75487844 GTACCAGTCCATGGCCTGTTAGG + Intronic
910315207 1:85874809-85874831 GTACCTGTCCAAGGCCTGTTAGG + Intronic
911147079 1:94562763-94562785 ATACCAGTCCATGGCCTGTTAGG - Intergenic
911894030 1:103406485-103406507 ATACCAGTCCCTGGCCTGTTAGG + Intergenic
912113016 1:106366851-106366873 ATACTGATTCATGGCCTGTTAGG - Intergenic
912353228 1:109034505-109034527 ATACTGATCCACAGCCTGTTAGG + Intronic
912750373 1:112282577-112282599 ATGCCAGTCCATGGCCTGTTAGG - Intergenic
913230366 1:116735999-116736021 GTACCGGTCCATGGCCTGTTAGG + Intergenic
913302765 1:117389523-117389545 GTACCAGTCCAGGGCCTGTTAGG - Intronic
913325020 1:117620601-117620623 ATACCAGTCCGTGGCCTGTTAGG + Intronic
916327009 1:163573795-163573817 ATCCCCAACCCAGGCTTGTTAGG + Intergenic
916965755 1:169940699-169940721 GTACCTGTCCATGGCCTGTTGGG - Intronic
917146058 1:171892967-171892989 ACACCTATCCATGGCCTGTTAGG - Intronic
917364010 1:174209220-174209242 ATACTGGTCCCAGGCCTGTTAGG - Intronic
917762911 1:178183093-178183115 GTACCAGTCCATGGCCTGTTAGG - Intronic
917987158 1:180332354-180332376 TTACCTGTCCATGGCCTGTTAGG + Intronic
918460115 1:184767752-184767774 GTACCCATCAGTGGCCTGTTAGG + Intergenic
918873358 1:190006360-190006382 ATACCTGTCCAAGGTCTGTTAGG + Intergenic
918906288 1:190499896-190499918 GTACCAGTCCATGGCCTGTTAGG + Intergenic
919099062 1:193071241-193071263 ATACCAGTCCGTGGCCTGTTAGG - Intronic
919282038 1:195502789-195502811 ATACTGGTCCATGGCCTGTTAGG + Intergenic
920904916 1:210154271-210154293 GTACCAGTCCATGGCCTGTTAGG + Intronic
921006019 1:211094351-211094373 CTACCAGTCCATGGCCTGTTAGG - Intronic
921151837 1:212408905-212408927 ATACGGGTCCATGGCCTGTTAGG + Intronic
921589881 1:216990957-216990979 ATATACATCCATGGCCTGTTAGG + Intronic
921748320 1:218763513-218763535 ATAGACATCCCAGCCCTGTTAGG - Intergenic
922093665 1:222422440-222422462 GTATCCATCCGTGGCCTGTTAGG + Intergenic
922275238 1:224071433-224071455 GTACCGGTCCATGGCCTGTTAGG + Intergenic
923619459 1:235566239-235566261 GTACCAGTCCATGGCCTGTTAGG + Intronic
924408482 1:243777373-243777395 GTACCAGTCCATGGCCTGTTAGG - Intronic
1064089036 10:12367836-12367858 GTACCAGTCCATGGCCTGTTAGG - Intronic
1064688576 10:17890790-17890812 GTACCAATCCATGGCCTGTTAGG + Intronic
1064942099 10:20746525-20746547 ATACCAGTCCATGGCCTGTTAGG + Intergenic
1065931529 10:30483560-30483582 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1066147729 10:32578740-32578762 ATACCAGTCCATGGCCTGTTAGG - Intronic
1068819652 10:61359590-61359612 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1070222477 10:74463619-74463641 ATACAAATCCATGGCCTGTTAGG - Intronic
1070691700 10:78531928-78531950 GTACTGATCCATGGCCTGTTAGG - Intergenic
1071909175 10:90211512-90211534 CTACCAGTCCATGGCCTGTTAGG - Intergenic
1073199954 10:101727276-101727298 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1073345622 10:102780996-102781018 ATACCCATCAAAGCCCTCTTAGG + Intronic
1073505653 10:103986580-103986602 GTACCAGTCCACGGCCTGTTAGG - Intronic
1073682529 10:105719638-105719660 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1073746863 10:106479151-106479173 GTACCCATCCATGGCTTGTTAGG + Intergenic
1074124518 10:110517448-110517470 ATACCAGTCAGAGGCCTGTTAGG + Intergenic
1074294330 10:112169716-112169738 ATACCGGTCCCCGGCCTGTTAGG + Intronic
1075917637 10:126182908-126182930 ATACCTGTCCGTGGCCTGTTAGG + Intronic
1076510614 10:131011547-131011569 ATTCCCTTCCAAGTCCTGTCTGG - Intergenic
1077426467 11:2481523-2481545 CTACCAGTCCATGGCCTGTTAGG + Intronic
1077471421 11:2762569-2762591 GTACCCATCCATAGACTGTTAGG + Intronic
1078009589 11:7562193-7562215 GTACCAGTCCATGGCCTGTTAGG - Intronic
1078229816 11:9430160-9430182 GTACCGGTCCATGGCCTGTTAGG - Intronic
1078330273 11:10413564-10413586 GTACCTGTCCATGGCCTGTTAGG - Intronic
1078352174 11:10603576-10603598 GTACCAAACCATGGCCTGTTAGG - Intronic
1079785911 11:24672846-24672868 GTACCAATCCGTGGCCTGTTAGG + Intronic
1080122330 11:28692051-28692073 ATACAGGTCCATGGCCTGTTAGG + Intergenic
1080190826 11:29546673-29546695 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1084984896 11:72860210-72860232 TTACCGGTCCATGGCCTGTTAGG - Intronic
1085157027 11:74305107-74305129 GTACCAGTCCATGGCCTGTTAGG - Intronic
1086042106 11:82492113-82492135 CTACCCATCCTTGGCCTGTTAGG + Intergenic
1086734337 11:90286979-90287001 GTACCCATCCATGGCCTGTTAGG - Intergenic
1086804043 11:91217275-91217297 GTACCAATCCATGGCCTTTTAGG - Intergenic
1087852323 11:103046429-103046451 GTACCTGTCCATGGCCTGTTAGG + Intergenic
1088609623 11:111564726-111564748 GGACCCATCCCTGGCCTGTTAGG + Intergenic
1089570747 11:119407376-119407398 GTACCAATCCATGGCCTATTAGG - Intergenic
1089833457 11:121349340-121349362 ATACGCATCTGTGGCCTGTTAGG + Intergenic
1089837576 11:121384459-121384481 GTACCCATCCGTGGCCTGTTGGG - Intergenic
1090122006 11:124039691-124039713 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1091115590 11:133009841-133009863 ATACCAGTCCATGCCCTGTTAGG - Intronic
1091425448 12:384245-384267 GTACCCATCAGCGGCCTGTTAGG + Intronic
1091643781 12:2257617-2257639 GTACCGGTCCATGGCCTGTTAGG - Intronic
1091755242 12:3047057-3047079 GTACCCATCCGTGGCCTGTTAGG + Intergenic
1092197842 12:6560653-6560675 AGACCCAGCCAAGGCCTCTCAGG + Intronic
1092766099 12:11854357-11854379 GTACCAGTCCATGGCCTGTTAGG - Intronic
1093746656 12:22749928-22749950 GTACCTGTCCATGGCCTGTTAGG - Intergenic
1094045533 12:26161949-26161971 GTACCCATCCATGGCCAGTTAGG - Intronic
1095184324 12:39184456-39184478 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1095915372 12:47472777-47472799 ATACTGGTCCATGGCCTGTTAGG + Intergenic
1096917604 12:55049988-55050010 GTCCCCATCCTTGGCCTGTTAGG - Intergenic
1097032129 12:56097349-56097371 GTACCAGTCCATGGCCTGTTAGG + Intronic
1097110336 12:56653230-56653252 GTACCCGTCCATGGCCTGTTAGG + Intergenic
1098125712 12:67290786-67290808 ATACAGATCCTTGGCCTGTTGGG + Intronic
1099155313 12:79168067-79168089 GTACCAGTCCATGGCCTGTTAGG - Intronic
1099352815 12:81593887-81593909 GTACCTGTCCATGGCCTGTTAGG + Intronic
1099703989 12:86127117-86127139 GTACCCATCAGTGGCCTGTTTGG - Intronic
1099748037 12:86732732-86732754 ATACTGGTCCATGGCCTGTTAGG - Intronic
1099970629 12:89496306-89496328 GTACCAGTCCATGGCCTGTTAGG - Intronic
1099974702 12:89534177-89534199 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1100424390 12:94469796-94469818 GTACCATTCCATGGCCTGTTAGG - Intergenic
1100506417 12:95225063-95225085 GTACCGGTCCATGGCCTGTTAGG - Intronic
1100755914 12:97750817-97750839 ATACCAGTCCATGGCCTGTTGGG - Intergenic
1101099295 12:101375966-101375988 ATACCTTTCAAAGTCCTGTTTGG + Intronic
1101335357 12:103791668-103791690 AAACCAGTCCAAGGTCTGTTAGG + Intronic
1101413458 12:104488775-104488797 ATACACATACCAAGCCTGTTTGG + Intronic
1103860007 12:124004610-124004632 GTACCAGTCCATGGCCTGTTAGG + Intronic
1103980104 12:124731604-124731626 ATACCAGTCCATGGCCTGTTAGG + Intergenic
1104681687 12:130756365-130756387 AGGCCAATTCAAGGCCTGTTAGG - Intergenic
1105500881 13:20970740-20970762 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1105760197 13:23507184-23507206 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1106344368 13:28861357-28861379 GTACCCATGCCAGGCCTGTCGGG - Intronic
1106821289 13:33467486-33467508 ATACCAGTCCATGGCCTGTTAGG - Intergenic
1107067129 13:36226534-36226556 TTACCCATCCATGGCCTGTTAGG - Intronic
1107506622 13:41040746-41040768 GTACCCATCCGTGGCCTGTTAGG - Intronic
1108015858 13:46074996-46075018 GTACCAGTCCATGGCCTGTTAGG - Intronic
1108333357 13:49412933-49412955 GTACCTGTCCATGGCCTGTTAGG - Exonic
1108487170 13:50938772-50938794 GTACCAATCCATGGCCTGTGAGG - Intronic
1109410721 13:61964252-61964274 GTACCAGTCCATGGCCTGTTGGG - Intergenic
1110146907 13:72202930-72202952 TTACTGGTCCAAGGCCTGTTAGG + Intergenic
1110477007 13:75928035-75928057 CTACCATTCCATGGCCTGTTGGG + Intergenic
1110579886 13:77109436-77109458 ATACTGGTCCAAGGCCTGTTAGG - Intronic
1110745122 13:79043464-79043486 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1112057852 13:95707271-95707293 GTACCAGTCCATGGCCTGTTAGG - Intronic
1112115322 13:96346133-96346155 GTACTGATCCATGGCCTGTTAGG - Intronic
1113212263 13:107997601-107997623 ATACCCACTCCTGGCCTGTTTGG + Intergenic
1113733523 13:112658992-112659014 AGACCCTTCCCAGGCCTCTTAGG + Intronic
1114028567 14:18554455-18554477 GTACCCATTAATGGCCTGTTAGG - Intergenic
1114368959 14:22063998-22064020 ATACACATCCAAGGCATTATAGG - Intergenic
1115159850 14:30381351-30381373 ATAAACATCCAAGGACTATTGGG + Intergenic
1115617877 14:35113510-35113532 ATTCCTATCCAAGAGCTGTTAGG + Intronic
1116089323 14:40284800-40284822 GTACCGATCCATGGCCTATTAGG - Intergenic
1117558114 14:56907381-56907403 GTACCAGTCCACGGCCTGTTAGG - Intergenic
1118551667 14:66957758-66957780 ATACCAGTCCATGACCTGTTAGG + Intronic
1118838050 14:69490472-69490494 GTACCAGTCCATGGCCTGTTAGG - Intronic
1119260379 14:73234792-73234814 GTACCTGTCCATGGCCTGTTAGG - Intergenic
1120178689 14:81321737-81321759 ACTCCCATTCATGGCCTGTTTGG - Intronic
1120428466 14:84381599-84381621 ATAACAGTCCATGGCCTGTTGGG - Intergenic
1120810923 14:88802718-88802740 CTACCCATCTGTGGCCTGTTAGG + Intergenic
1120924365 14:89783018-89783040 GTACAAATCCATGGCCTGTTAGG - Intergenic
1122660018 14:103288906-103288928 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1124140515 15:27073122-27073144 ACACCCATCCAAAGCATGATAGG + Intronic
1126027570 15:44462629-44462651 GTACCAGTCCATGGCCTGTTAGG - Intronic
1126111984 15:45180703-45180725 ATACACCTCCCAGGCCTGTTAGG + Intronic
1126721125 15:51581085-51581107 CTACCAGTCCATGGCCTGTTAGG + Intronic
1127681466 15:61302437-61302459 ACCCCCATCCATGGCCTGTTAGG + Intergenic
1127832305 15:62761673-62761695 ATCCCCATCCAGGGCCTGATGGG - Exonic
1128176033 15:65556535-65556557 ATACTGGTCCATGGCCTGTTGGG - Intronic
1128934964 15:71738339-71738361 ACACCAGTCCATGGCCTGTTAGG - Intronic
1130743175 15:86623137-86623159 ATACCGCTGCATGGCCTGTTAGG - Intronic
1130940871 15:88507857-88507879 ATACCTGTCCACGGACTGTTAGG + Intergenic
1132164735 15:99574761-99574783 GTACCAGTCCATGGCCTGTTAGG - Intronic
1133863757 16:9621818-9621840 GTACCAATCCGTGGCCTGTTAGG - Intergenic
1135127658 16:19824462-19824484 GTACCGGTCCATGGCCTGTTAGG - Intronic
1135300330 16:21321257-21321279 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1135693486 16:24565428-24565450 GTATCCATCCTTGGCCTGTTAGG + Intronic
1135798679 16:25472173-25472195 TTACCAGTCCATGGCCTGTTAGG + Intergenic
1135852729 16:25979308-25979330 GTACCATTCCATGGCCTGTTAGG + Intronic
1136670848 16:31855533-31855555 ATACCCACCCCTGGCTTGTTAGG + Intergenic
1137240015 16:46648192-46648214 ATACCAGTCCCTGGCCTGTTGGG + Intergenic
1137306281 16:47203760-47203782 GTACCAATCCATGGCCTGTTAGG - Intronic
1137386662 16:48048453-48048475 AAACCCATCCCAGGACAGTTGGG + Intergenic
1138109562 16:54312781-54312803 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1139445492 16:66995705-66995727 ACACCCATCCAAGTCTTTTTAGG + Exonic
1140241436 16:73204621-73204643 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1140884622 16:79232154-79232176 GTACCAATCCATGGCCTGTTAGG - Intergenic
1141598143 16:85109930-85109952 AGACACATCCAAGGCCTATGAGG - Intronic
1143812288 17:9481681-9481703 ACACCAGTCCATGGCCTGTTAGG + Intronic
1144667067 17:17109111-17109133 AGACCTTTCCAAGGCATGTTTGG - Intronic
1146721764 17:35129122-35129144 ATAGCAGTCCATGGCCTGTTAGG - Intronic
1147505872 17:41016811-41016833 ATACCTGTCCCTGGCCTGTTAGG - Intronic
1148709066 17:49663105-49663127 TTACCGACCCATGGCCTGTTAGG + Intronic
1149025921 17:52027334-52027356 ATACCAGTCAGAGGCCTGTTAGG - Intronic
1149270919 17:54976582-54976604 GTAGCCGTCCATGGCCTGTTAGG + Intronic
1149314680 17:55427889-55427911 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1150025586 17:61670741-61670763 ATACCCAACAAAGCTCTGTTGGG + Intergenic
1150532846 17:66003666-66003688 ATACAGGTCCATGGCCTGTTAGG + Intronic
1151254580 17:72866046-72866068 GTATCCGTCCATGGCCTGTTAGG + Intronic
1151573686 17:74940484-74940506 GTACCAGTCCATGGCCTGTTAGG + Intronic
1151652205 17:75476999-75477021 ATACCCTGCCAAGGCATGTGAGG + Intronic
1153536685 18:6109556-6109578 ATACCATTCCAGAGCCTGTTTGG + Intronic
1154107413 18:11534421-11534443 CTACTCATCCAAGGCCTGGCAGG - Intergenic
1154170222 18:12046163-12046185 CTACCCACCCAAGGCCTGGCTGG + Intergenic
1154404675 18:14078221-14078243 GTACCTGTCCATGGCCTGTTAGG - Intronic
1155108013 18:22686930-22686952 GTACCAATCCATGGCCTGTTAGG - Intergenic
1155528146 18:26738484-26738506 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1157449944 18:47778434-47778456 ATAGCTGTCCATGGCCTGTTAGG - Intergenic
1157459289 18:47872553-47872575 ATACCGGTCCACGGCCTGTTAGG + Intronic
1157468522 18:47969295-47969317 GTACCCATCCATGGCCTGTTAGG + Intergenic
1160398952 18:78594867-78594889 GTACCCATCCATGGGCTGTTAGG - Intergenic
1160606792 18:80057693-80057715 GTACCCATCTGTGGCCTGTTAGG + Intronic
1160609798 18:80076081-80076103 CTACCCGTCCATGGCCTGTTAGG + Intronic
1162609118 19:11735715-11735737 ATACCCATGTAAGGCATGTAAGG - Intronic
1162655582 19:12126652-12126674 GTACCTGTCCATGGCCTGTTAGG - Intronic
1163193818 19:15699744-15699766 ATACCAATCCGATGCATGTTAGG - Intergenic
1163754050 19:19096110-19096132 TTACCCATACCAGGCCTGCTCGG - Exonic
1164410507 19:28000881-28000903 ATTCCTTACCAAGGCCTGTTTGG - Intergenic
1165053692 19:33160165-33160187 GTACCAATCCATGGCCTGTTGGG - Intronic
1166017195 19:39991237-39991259 GTACCAGTCCATGGCCTGTTAGG - Intronic
925221897 2:2148476-2148498 CTACCTATCCGTGGCCTGTTAGG - Intronic
925891429 2:8438129-8438151 GTATCCATCCATGGCCTGTTAGG + Intergenic
926358395 2:12062503-12062525 AAACCCATCCACGGCATATTAGG + Intergenic
926847006 2:17152432-17152454 GTACTGATCCCAGGCCTGTTAGG - Intergenic
927856839 2:26533004-26533026 GTACCAGTCCATGGCCTGTTAGG + Intronic
928252366 2:29692695-29692717 GTACCTGTCCATGGCCTGTTAGG - Intronic
929184600 2:39080417-39080439 ATACTGGTCCATGGCCTGTTAGG - Intronic
930510154 2:52334658-52334680 GTACCCATCCATGGACTATTAGG + Intergenic
930842686 2:55864889-55864911 GTACCTGTCCATGGCCTGTTAGG - Intergenic
931094819 2:58927192-58927214 GTACCTGTCCATGGCCTGTTAGG - Intergenic
932340577 2:70960623-70960645 ATACCCCTCCACAGCCTGCTGGG - Intronic
933006114 2:76997718-76997740 GTACCAGTCCATGGCCTGTTAGG + Intronic
933057032 2:77683366-77683388 GTACCAGTCCATGGCCTGTTAGG - Intergenic
933072107 2:77871720-77871742 GTACCAGTCCATGGCCTGTTAGG - Intergenic
933674083 2:85037806-85037828 ATACCCGTCCATGACCTGTTTGG + Intronic
933927164 2:87104509-87104531 GTACCAGTCCATGGCCTGTTAGG - Intergenic
934887923 2:98040881-98040903 ATACCCCTCCAACTCCTTTTTGG + Intergenic
935108705 2:100072145-100072167 ATAACAGTCCATGGCCTGTTAGG + Intronic
935925171 2:108060332-108060354 ATAGCCAGTCAAGGCTTGTTTGG - Intergenic
941504934 2:166330867-166330889 ATACTGGTCCATGGCCTGTTAGG - Intronic
941841642 2:170091584-170091606 ATACCAGTCCAAGGCCTGTTAGG + Intergenic
942261666 2:174171727-174171749 CTGCCCATCAAACGCCTGTTTGG - Intronic
943657762 2:190527677-190527699 ATACCAGTCCATGGTCTGTTAGG + Intronic
943745202 2:191454922-191454944 GTACCAGTCCATGGCCTGTTAGG - Intergenic
946927051 2:224636470-224636492 GTACCAATCCGTGGCCTGTTAGG + Intergenic
947561732 2:231160032-231160054 AGACCTGTCCATGGCCTGTTAGG - Intronic
947726727 2:232406106-232406128 AGACCCAGCCCAGGCCTGTCTGG + Intergenic
948394938 2:237638462-237638484 GTACCAGTCCATGGCCTGTTAGG - Intronic
1169482892 20:6001347-6001369 GTACCAATCCATGGCCTGTTAGG - Intergenic
1169640037 20:7741482-7741504 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1170018833 20:11813291-11813313 ATACCGGTCTGAGGCCTGTTAGG - Intergenic
1170789738 20:19497896-19497918 GTACCAATCCCTGGCCTGTTAGG + Intronic
1172181630 20:33007398-33007420 ATGCCCAGCCAAGGCCTGGGAGG - Intergenic
1172280510 20:33704485-33704507 GTACCGGTCCATGGCCTGTTCGG - Exonic
1172757125 20:37293554-37293576 GTACCAGTCCATGGCCTGTTAGG - Intronic
1173135291 20:40433687-40433709 ATCCCCATCTCAGGCCTCTTGGG - Intergenic
1173477123 20:43367986-43368008 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1173810370 20:45951719-45951741 GTAGTCATCCATGGCCTGTTAGG - Intronic
1174144394 20:48440968-48440990 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1174365143 20:50052130-50052152 GTACCCATTCGTGGCCTGTTAGG - Intergenic
1174633700 20:51980423-51980445 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1174957390 20:55114458-55114480 ATACCCAGCCAAGGCATGCCTGG + Intergenic
1175924212 20:62464056-62464078 TGACCCATCCAAGCGCTGTTGGG - Exonic
1178148743 21:29769664-29769686 GTACCGGTCCATGGCCTGTTAGG - Intronic
1178297342 21:31421382-31421404 ATACCAGTCTATGGCCTGTTAGG + Intronic
1178306726 21:31497091-31497113 ATACCGGTCAATGGCCTGTTAGG - Intronic
1179114915 21:38482106-38482128 ATTCCCATCCATGGCCTGGAAGG + Intronic
1180452687 22:15481505-15481527 GTACCCATTAATGGCCTGTTAGG - Intergenic
1181020161 22:20096098-20096120 GTACCAATCCATGGCCTGTTAGG - Intronic
1181780608 22:25190437-25190459 ATACTGGTCCATGGCCTGTTAGG - Intronic
1182525890 22:30918896-30918918 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1184565736 22:45290674-45290696 GTACCAGTCCATGGCCTGTTAGG + Intronic
1184623826 22:45705858-45705880 GTACCTGTCCATGGCCTGTTAGG + Intronic
949378466 3:3417058-3417080 GTACCCTTCCATGGCCCGTTAGG + Intergenic
949606285 3:5657790-5657812 ATACCCATCATAGCCCTGTGGGG - Intergenic
950487185 3:13280845-13280867 AGACACAGCCAAGGCCTGTGAGG - Intergenic
951553588 3:23898794-23898816 GTACCAGTCCAGGGCCTGTTAGG + Intronic
952090413 3:29878244-29878266 GTAGCCATCCATGGCCTGTTAGG - Intronic
952365561 3:32671792-32671814 GTACCAGTCCATGGCCTGTTAGG - Intergenic
952459036 3:33504897-33504919 GTACTGATCCATGGCCTGTTAGG - Intronic
952566591 3:34666470-34666492 GTACCTGTCCATGGCCTGTTAGG - Intergenic
954731386 3:52665511-52665533 CTACCAGTCCATGGCCTGTTTGG + Intronic
954766047 3:52917593-52917615 GTACCCGTCTATGGCCTGTTAGG + Intronic
954924558 3:54220957-54220979 ATTCCCACCCAAGGCCTCGTAGG - Intronic
955022234 3:55132597-55132619 ATACCAGTCCGTGGCCTGTTAGG + Intergenic
955100521 3:55845149-55845171 ATACTGATCCATGTCCTGTTAGG - Intronic
955851409 3:63224118-63224140 GTACTGATCCATGGCCTGTTAGG + Intergenic
956298273 3:67738453-67738475 GTACCAATCCGTGGCCTGTTAGG - Intergenic
956438694 3:69259382-69259404 CTACCAGTCCATGGCCTGTTAGG - Intronic
957724250 3:84044461-84044483 GTACCCATCCGTGGCCTGTTAGG - Intergenic
958972030 3:100622132-100622154 GTACCAATCCATGGCCTATTAGG - Intronic
959181519 3:102986311-102986333 GTACCACTCCATGGCCTGTTAGG - Intergenic
960775410 3:121246067-121246089 GTACCAGTCCATGGCCTGTTAGG + Intronic
960796279 3:121491817-121491839 GTACCAGTCCATGGCCTGTTAGG + Intronic
960879713 3:122332110-122332132 GTACCCATCCATGGCCTGTTAGG - Intronic
961246010 3:125454236-125454258 ATACCAGTCCATGGCCTGTTTGG + Intronic
962002133 3:131309076-131309098 GTACCAGTCCATGGCCTGTTAGG - Intronic
962181885 3:133214700-133214722 GTACCAGTCCATGGCCTGTTAGG + Intronic
962825439 3:139096328-139096350 ATACTCATCCCAGGACTCTTTGG - Intronic
964737467 3:159931383-159931405 GTACCAGTCCATGGCCTGTTAGG - Intergenic
967455146 3:189676736-189676758 GTACCCATCTGTGGCCTGTTAGG + Intronic
967663127 3:192137441-192137463 ATACCCATGCAAGCACTGCTAGG - Intergenic
968100668 3:195962537-195962559 TTACCAGTCCATGGCCTGTTAGG - Intergenic
969055560 4:4399981-4400003 GTACCAGTCCATGGCCTGTTAGG - Intronic
969120865 4:4910106-4910128 GTACCGATCCTTGGCCTGTTAGG + Intergenic
970929822 4:21496658-21496680 GTACCAGTCCATGGCCTGTTAGG + Intronic
971743871 4:30553572-30553594 GTACTCATCCATGGCCTGTTAGG + Intergenic
971790173 4:31160151-31160173 ATCCTCATCCAAGGTTTGTTTGG + Intergenic
972061476 4:34879093-34879115 CTATGCATCCATGGCCTGTTAGG + Intergenic
972419918 4:38877593-38877615 GTACCAGTCCATGGCCTGTTAGG - Intronic
972556468 4:40186528-40186550 GTACCCACCCGTGGCCTGTTAGG - Intergenic
973595673 4:52486596-52486618 GTACCCATCCATGGCCTCTTAGG - Intergenic
973664557 4:53144891-53144913 GTACCCGTCCATGGCCTGTTAGG + Intronic
974009173 4:56592006-56592028 ATACCGGTCCGTGGCCTGTTAGG + Intronic
974897125 4:67953205-67953227 GTACCTGTCCATGGCCTGTTAGG - Intronic
975932087 4:79537463-79537485 GTACCAGTCCATGGCCTGTTAGG + Intergenic
976165258 4:82247773-82247795 GTACCAGTCCATGGCCTGTTAGG + Intergenic
976508516 4:85880016-85880038 GTACTGATCCATGGCCTGTTAGG - Intronic
977173344 4:93789846-93789868 GTACCAATCCATGGCCTGTTAGG + Intergenic
977235143 4:94499675-94499697 GTACAGATCCATGGCCTGTTAGG + Intronic
977612492 4:99050573-99050595 GTACCAATCCATGGCCTGTTAGG + Intronic
978671006 4:111247123-111247145 GTACCAGTCCATGGCCTGTTAGG + Intergenic
978747751 4:112212930-112212952 GCCCCCATCCATGGCCTGTTGGG - Intergenic
979055125 4:115983987-115984009 ATACCGGTCCATGCCCTGTTAGG + Intergenic
979372507 4:119906490-119906512 GTACCTATCCACGGCCTGTTAGG - Intergenic
979790976 4:124780878-124780900 ATACCTGTCCCTGGCCTGTTAGG + Intergenic
981527678 4:145722681-145722703 GTACCAGTCCATGGCCTGTTAGG + Intronic
981609479 4:146578045-146578067 GTACCCATCCATGTCCTGTTAGG - Intergenic
981728086 4:147868890-147868912 GTACCGGTCCATGGCCTGTTAGG - Intronic
981784489 4:148462136-148462158 GTACCGGTCCATGGCCTGTTAGG + Intergenic
982679216 4:158408961-158408983 CCACCAATCCATGGCCTGTTAGG - Intronic
982899741 4:160983172-160983194 GTACCAGTCCATGGCCTGTTAGG + Intergenic
983274745 4:165603451-165603473 GTACCAGTCCATGGCCTGTTAGG - Intergenic
983631844 4:169857275-169857297 GTACCAGTCCATGGCCTGTTAGG - Intergenic
984364971 4:178786533-178786555 GTACCAGTCCATGGCCTGTTAGG - Intergenic
984861771 4:184246696-184246718 GTACCCATCCATGGCCTGTTAGG - Intergenic
985502404 5:257248-257270 TTACCAGTCCATGGCCTGTTAGG + Intergenic
985622773 5:964178-964200 AGACCCATCCAAAGCCGTTTGGG - Intergenic
985678851 5:1245732-1245754 ATTCCCATCCAAGTCCGGGTGGG + Intronic
985734615 5:1571349-1571371 TTACCAGTCCATGGCCTGTTAGG - Intergenic
986575151 5:9204747-9204769 GTACCAGTCCATGGCCTGTTAGG + Intronic
986778124 5:11038223-11038245 ATACTGGTCCATGGCCTGTTAGG + Intronic
987222480 5:15804609-15804631 GTACCCATCCATGACCTGTTAGG + Intronic
987993358 5:25244205-25244227 GTACCAGTCCATGGCCTGTTAGG - Intergenic
988135916 5:27171735-27171757 ATACCAGTCCCTGGCCTGTTAGG + Intergenic
988240288 5:28599574-28599596 ATAGCCCTCCCAGGCCTATTAGG + Intergenic
988902817 5:35752187-35752209 GTACCCATCCATGGCTTGTTAGG - Intronic
988989333 5:36654206-36654228 ACACCCCTCCAGGGGCTGTTAGG + Intronic
989469183 5:41795301-41795323 GTACCGGTCCATGGCCTGTTAGG - Intronic
989625635 5:43426986-43427008 GTACCATTCCATGGCCTGTTAGG - Intergenic
991036849 5:62135928-62135950 ATACCGGTCTATGGCCTGTTAGG - Intergenic
991316215 5:65309557-65309579 GTCCCCAACCATGGCCTGTTAGG - Intronic
991332884 5:65511577-65511599 GTACCAGTCCATGGCCTGTTAGG + Intergenic
992307883 5:75462526-75462548 GTACCAGTCCATGGCCTGTTAGG - Intronic
992485696 5:77192146-77192168 ATACCAGTCCGTGGCCTGTTGGG - Intergenic
992936108 5:81707082-81707104 ATACCCATGAAAGGCATTTTTGG - Intronic
993828945 5:92729275-92729297 ATACTGGTCCATGGCCTGTTAGG + Intergenic
993923065 5:93831171-93831193 GTACCAGTCCATGGCCTGTTAGG - Intronic
994163592 5:96584347-96584369 ATACTGATCCCTGGCCTGTTAGG - Intronic
997172408 5:131736505-131736527 GTACCAGTCCATGGCCTGTTAGG + Intronic
997648922 5:135500625-135500647 ATACCAGTCCATGGCCTGTTAGG + Intergenic
999090076 5:148928231-148928253 AAACTCAACCAAGGCCTGTCTGG - Intronic
999516897 5:152310690-152310712 GTACCAGTCCATGGCCTGTTAGG - Intergenic
999571493 5:152924915-152924937 GTACCCATCCATGGCTTGTTAGG + Intergenic
1000387999 5:160693884-160693906 ATAGCAGTCCATGGCCTGTTGGG - Intronic
1000621257 5:163489272-163489294 ATACCCATCCAAGGCCTGTTAGG - Intronic
1001631005 5:173175467-173175489 GTACCAATTCATGGCCTGTTAGG - Intergenic
1002625753 5:180527768-180527790 GTACTCGTCCATGGCCTGTTAGG + Intronic
1003850790 6:10220476-10220498 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1004556773 6:16705914-16705936 AGACCCATTCAAGGACTGTAGGG - Intronic
1004911826 6:20293170-20293192 GTACCCATCAGTGGCCTGTTAGG - Intergenic
1004982308 6:21039072-21039094 ATACCAGTCCATGGCCTGTTAGG + Intronic
1005031801 6:21515856-21515878 ATTCCCAACCAAAGTCTGTTGGG - Intergenic
1005932763 6:30496194-30496216 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1007420889 6:41718944-41718966 ATACTAATCCATGGCCGGTTAGG + Intronic
1007506944 6:42342943-42342965 TGACCCATCCAAGGCCTCTCTGG + Intronic
1011216331 6:85009721-85009743 GTACCTGTCCATGGCCTGTTAGG - Intergenic
1011570645 6:88730661-88730683 GTACCAGTCCATGGCCTGTTAGG - Intronic
1011785237 6:90836325-90836347 ATCACCATCCCAGGCCTATTTGG - Intergenic
1012059034 6:94453747-94453769 ATATCCATCCAAGTTGTGTTAGG - Intergenic
1013045201 6:106478658-106478680 ATACCAGTCCATGACCTGTTAGG + Intergenic
1013420883 6:109965715-109965737 GTACTAATCCATGGCCTGTTAGG + Intergenic
1014136794 6:117898686-117898708 ATACCAATCCATGGCCTGTTAGG + Intergenic
1014227342 6:118862738-118862760 GTTCCCAACCATGGCCTGTTAGG - Intronic
1014541013 6:122676395-122676417 GTACCAATCCATGGCCTGTTAGG - Intronic
1015942759 6:138468393-138468415 GTACCCATCTGTGGCCTGTTAGG + Intronic
1016783752 6:147988230-147988252 ACACCCATCCCAGGCATGATAGG + Intergenic
1016785420 6:148006027-148006049 ATACCAGTCCATGGTCTGTTAGG - Intergenic
1016844984 6:148560942-148560964 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1017244677 6:152209970-152209992 GTAACCATCCAAGGCCTCTTAGG + Intronic
1017547179 6:155465047-155465069 GTACCCATCCATAGCCTGTAAGG - Intergenic
1017784851 6:157747130-157747152 GTACCAGTCCATGGCCTGTTAGG - Intronic
1018190816 6:161307855-161307877 ATATCCATCCAAGTGCTGTTGGG + Intergenic
1019466320 7:1191359-1191381 GCACCCATCCATGGCCTGTTAGG + Intergenic
1019852173 7:3570441-3570463 GTACCCGTCCATAGCCTGTTAGG - Intronic
1021448674 7:20760562-20760584 GTACCAATCCATGGCCTGTTAGG + Intronic
1021519342 7:21523607-21523629 ATAACCATACAAGCCCTGTGCGG - Intergenic
1024180549 7:46889036-46889058 ATAGCCATGCAATGCCTGTCAGG - Intergenic
1024276684 7:47683108-47683130 ACACCCATCCCAGGGCTGTCTGG + Intergenic
1024493724 7:50017454-50017476 GTACCAATCCATGGCCTGTTAGG - Intronic
1027672464 7:81118840-81118862 ATACCCAAGCAAGGCCTGGGTGG - Intergenic
1027889408 7:83951229-83951251 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1028057218 7:86261301-86261323 AGACCCGTCCATGGCCTGTTAGG - Intergenic
1028570298 7:92279231-92279253 GTACCTGTCCATGGCCTGTTAGG - Intronic
1029355512 7:100048954-100048976 ATACCAGTCCATGGCCTGTTAGG - Intergenic
1030182107 7:106721030-106721052 GGGCCCATCCATGGCCTGTTAGG + Intergenic
1030845187 7:114400789-114400811 GTACCAGTCCATGGCCTGTTAGG - Intronic
1031430057 7:121657105-121657127 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1031497224 7:122465417-122465439 GTACCAATCCATGGCCTGTTTGG + Intronic
1032231234 7:130076269-130076291 GTACCGGTCCATGGCCTGTTAGG - Intronic
1032587841 7:133164040-133164062 AGACTCGTCCATGGCCTGTTAGG - Intergenic
1032707314 7:134432612-134432634 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1033135458 7:138780434-138780456 GTACCAGTCCATGGCCTGTTAGG - Intronic
1033335241 7:140446720-140446742 GTACCAATCCGTGGCCTGTTAGG - Intergenic
1033684785 7:143628440-143628462 GTACCAGTCCATGGCCTGTTAGG + Intronic
1033687960 7:143707659-143707681 GTACCAGTCCATGGCCTGTTAGG + Intronic
1033699827 7:143829181-143829203 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1035112522 7:156495077-156495099 ATACCTGTCCATGGCCTGTTAGG + Intergenic
1035962929 8:4157684-4157706 AGACCCACCCAAGGCCGGTTGGG - Intronic
1036226681 8:6964996-6965018 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1037053767 8:14409990-14410012 GTAACCCTCCATGGCCTGTTAGG + Intronic
1037288980 8:17330835-17330857 ATCCCCATTCAAGGCCATTTAGG - Intronic
1037514520 8:19617316-19617338 GTACTCATCCATGGCCTGCTAGG - Intronic
1037923350 8:22824906-22824928 GTACCGGTCCATGGCCTGTTAGG - Intronic
1038243760 8:25834617-25834639 GTACCAATCCATGGCCTGTTAGG + Intergenic
1038324447 8:26561896-26561918 GTACCCGTCCATGGCCTATTAGG - Intronic
1038829143 8:31037407-31037429 GTACCAGTCCATGGCCTGTTAGG - Intronic
1039114242 8:34074496-34074518 GTACCCATCTGTGGCCTGTTAGG - Intergenic
1039989034 8:42472373-42472395 ATACTCATCCATGGCCATTTTGG + Exonic
1041333622 8:56755200-56755222 ATACCAGTCCTTGGCCTGTTAGG - Intergenic
1041819134 8:62009653-62009675 GTACCGCTCCATGGCCTGTTAGG - Intergenic
1042928452 8:73990405-73990427 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1043417921 8:80070642-80070664 GTACCCATCTGTGGCCTGTTAGG - Intronic
1044067142 8:87712830-87712852 GTACCCATCCTTGGCCTGTTAGG + Intergenic
1044519010 8:93176313-93176335 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1044677950 8:94748550-94748572 GTACCCATCAGAGGCCTGTTAGG + Intronic
1044866394 8:96575104-96575126 ATACCGATCCGTGGCCTGTTAGG - Intronic
1045574932 8:103410279-103410301 GTACCAATCCATGGCCTGTTAGG + Intronic
1047260796 8:123257807-123257829 GTACCAATCCATGACCTGTTAGG - Intronic
1048005020 8:130412022-130412044 ATACCCATACAGGGCCTGCGTGG - Intronic
1048258472 8:132924332-132924354 GTACCAGTCCATGGCCTGTTAGG - Intronic
1048434306 8:134401744-134401766 GTACTCTTCCATGGCCTGTTAGG + Intergenic
1048587024 8:135783602-135783624 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1048980287 8:139699726-139699748 ATATCCCTCCAAAGCCTTTTAGG + Intronic
1050127669 9:2376066-2376088 GTACCAATCCGTGGCCTGTTAGG - Intergenic
1050424093 9:5496227-5496249 GTACCCATCCATGGCCTGTTAGG + Intergenic
1050658968 9:7862294-7862316 GTACCCATCCTTGGCTTGTTAGG + Intronic
1051286412 9:15501928-15501950 GTACCCGTCCGTGGCCTGTTAGG + Intronic
1051831904 9:21288707-21288729 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1052038073 9:23705808-23705830 ATACCAGTCCGTGGCCTGTTAGG - Intronic
1055057905 9:72040350-72040372 ATACTGGTCCATGGCCTGTTAGG - Intergenic
1055965417 9:81860932-81860954 GTACCAGTCCATGGCCTGTTAGG - Intergenic
1057572253 9:96213662-96213684 GTACCAGTCCATGGCCTGTTAGG + Intergenic
1058591612 9:106571421-106571443 ACACACACCCAGGGCCTGTTGGG + Intergenic
1058864727 9:109151289-109151311 GTACCAGTCCATGGCCTGTTAGG + Intronic
1059018962 9:110552757-110552779 ATGCTGATCCATGGCCTGTTAGG - Intronic
1059996243 9:119913166-119913188 ATACTGCTCCATGGCCTGTTAGG - Intergenic
1060126098 9:121048277-121048299 ATACCAGTCCATGGCTTGTTAGG + Intronic
1185708788 X:2285598-2285620 GTACCAGTCCATGGCCTGTTAGG - Intronic
1186221672 X:7355746-7355768 CTACCAGTCCATGGCCTGTTAGG + Intergenic
1186463139 X:9764688-9764710 ATTCCCATCCAAGGGACGTTGGG - Intronic
1187013906 X:15307604-15307626 GTACCAGTCCATGGCCTGTTAGG - Intronic
1188224760 X:27583573-27583595 TTACCCTTCCATGGTCTGTTAGG + Intergenic
1189503315 X:41584713-41584735 GTACCCATCCGTGGCCTGTTAGG - Intronic
1190068750 X:47261844-47261866 ATACCAGTCCATGGCCTGTTAGG - Intergenic
1190949939 X:55133535-55133557 ATACCTATCCAAGAAATGTTTGG - Intronic
1194282258 X:91967290-91967312 GTACCTATCCATGGCCTGTTAGG + Intronic
1194786260 X:98087563-98087585 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1195219198 X:102730391-102730413 GGACCCGTCCATGGCCTGTTAGG - Intronic
1195928431 X:110049596-110049618 GTACCAATCTATGGCCTGTTAGG - Intronic
1196902931 X:120403499-120403521 ATACCAGTCCATGGCCTGTTAGG - Intergenic
1197056056 X:122120617-122120639 ATACTCATCCAAGGTCTGCTTGG - Intergenic
1199210005 X:145196809-145196831 ACACCCAGTCTAGGCCTGTTAGG - Intergenic
1199659930 X:150038574-150038596 ATACCAGTCCGTGGCCTGTTAGG - Intergenic
1200599847 Y:5191941-5191963 GTACCTATCCATGGCCTGTTAGG + Intronic