ID: 1000621260

View in Genome Browser
Species Human (GRCh38)
Location 5:163489287-163489309
Sequence ATGGGTATTGGTCTGTAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000621251_1000621260 11 Left 1000621251 5:163489253-163489275 CCTGCTCTGCAGCCGGGTTCCTA 0: 1
1: 33
2: 332
3: 802
4: 1348
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621247_1000621260 21 Left 1000621247 5:163489243-163489265 CCACTTACCTCCTGCTCTGCAGC 0: 3
1: 27
2: 332
3: 584
4: 1275
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621254_1000621260 -1 Left 1000621254 5:163489265-163489287 CCGGGTTCCTAACAGGCCTTGGA 0: 4
1: 217
2: 628
3: 1120
4: 1352
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621257_1000621260 -8 Left 1000621257 5:163489272-163489294 CCTAACAGGCCTTGGATGGGTAT 0: 1
1: 0
2: 9
3: 72
4: 371
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621250_1000621260 14 Left 1000621250 5:163489250-163489272 CCTCCTGCTCTGCAGCCGGGTTC 0: 1
1: 31
2: 293
3: 761
4: 1407
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data
1000621246_1000621260 30 Left 1000621246 5:163489234-163489256 CCTGGCTCACCACTTACCTCCTG 0: 1
1: 1
2: 4
3: 51
4: 373
Right 1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000621260 Original CRISPR ATGGGTATTGGTCTGTAGCC CGG Intronic
No off target data available for this crispr