ID: 1000621622

View in Genome Browser
Species Human (GRCh38)
Location 5:163492964-163492986
Sequence AGTTATCTGCATAGGATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000621616_1000621622 23 Left 1000621616 5:163492918-163492940 CCTACTGAAGCCCAGCAGTAGGC No data
Right 1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG No data
1000621618_1000621622 12 Left 1000621618 5:163492929-163492951 CCAGCAGTAGGCCCAGAGCTGTT No data
Right 1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG No data
1000621619_1000621622 1 Left 1000621619 5:163492940-163492962 CCCAGAGCTGTTTCTCAAAAGAG No data
Right 1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG No data
1000621617_1000621622 13 Left 1000621617 5:163492928-163492950 CCCAGCAGTAGGCCCAGAGCTGT No data
Right 1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG No data
1000621620_1000621622 0 Left 1000621620 5:163492941-163492963 CCAGAGCTGTTTCTCAAAAGAGT No data
Right 1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG No data
1000621614_1000621622 24 Left 1000621614 5:163492917-163492939 CCCTACTGAAGCCCAGCAGTAGG No data
Right 1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000621622 Original CRISPR AGTTATCTGCATAGGATAAC AGG Intergenic
No off target data available for this crispr