ID: 1000622911

View in Genome Browser
Species Human (GRCh38)
Location 5:163505624-163505646
Sequence CCTCCAACCCAGGATCGACG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000622911_1000622921 15 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622921 5:163505662-163505684 AGGCTGCGGCGTGAAGACGGCGG 0: 1
1: 0
2: 2
3: 13
4: 115
1000622911_1000622924 24 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622924 5:163505671-163505693 CGTGAAGACGGCGGGCATGGTGG 0: 1
1: 0
2: 0
3: 13
4: 164
1000622911_1000622922 16 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622922 5:163505663-163505685 GGCTGCGGCGTGAAGACGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 162
1000622911_1000622926 26 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622926 5:163505673-163505695 TGAAGACGGCGGGCATGGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 148
1000622911_1000622928 30 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622928 5:163505677-163505699 GACGGCGGGCATGGTGGGGCGGG 0: 1
1: 0
2: 1
3: 49
4: 398
1000622911_1000622920 12 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622920 5:163505659-163505681 CTGAGGCTGCGGCGTGAAGACGG 0: 1
1: 0
2: 1
3: 23
4: 295
1000622911_1000622918 1 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622918 5:163505648-163505670 GGTGGCGGCCGCTGAGGCTGCGG 0: 1
1: 0
2: 6
3: 91
4: 859
1000622911_1000622923 21 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622923 5:163505668-163505690 CGGCGTGAAGACGGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 69
1000622911_1000622917 -5 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622917 5:163505642-163505664 GGAGGAGGTGGCGGCCGCTGAGG 0: 1
1: 0
2: 16
3: 185
4: 1425
1000622911_1000622927 29 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622927 5:163505676-163505698 AGACGGCGGGCATGGTGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 304
1000622911_1000622925 25 Left 1000622911 5:163505624-163505646 CCGCGTCGATCCTGGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1000622925 5:163505672-163505694 GTGAAGACGGCGGGCATGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000622911 Original CRISPR CCTCCAACCCAGGATCGACG CGG (reversed) Exonic
905465853 1:38152600-38152622 CCTCCTGCCCAGGATCTATGGGG - Intergenic
905707766 1:40074962-40074984 CATCCAACCCAGGACAGGCGCGG + Intronic
917986498 1:180325899-180325921 ACTCCACCCCAGGATCCAAGTGG - Intronic
918820118 1:189242956-189242978 CCTCCAACTCAGAATTGACCAGG + Intergenic
923250462 1:232175776-232175798 CTTCCAACCCTGGAACGAAGAGG + Intergenic
924539756 1:244970322-244970344 CCTCCAGGCCAGGCTCGCCGCGG + Exonic
1076783161 10:132735589-132735611 CCACCAGCCCAGGACCGAGGGGG - Intronic
1083611350 11:64005886-64005908 CCTCCAGCCCAGGAAGGACCAGG + Intronic
1089613344 11:119681675-119681697 CCTCCACCCCAACATAGACGTGG - Intronic
1108809226 13:54200772-54200794 ACTCCAACCCAGGATCCACCTGG - Intergenic
1112567180 13:100561721-100561743 CCTCCAACCCAGGACCCTGGAGG + Intronic
1114051393 14:18921649-18921671 GCTCCAAGCCAGGATGGAGGAGG + Intergenic
1114111168 14:19480276-19480298 GCTCCAAGCCAGGATGGAGGAGG - Intergenic
1124340537 15:28886813-28886835 CCTGCAGCCCAGGAGCAACGGGG - Intronic
1138680221 16:58678631-58678653 CCTCCACCCCAGGATCCCTGGGG + Intronic
1139529849 16:67537717-67537739 CCTCCACCCCGGCATCGGCGGGG - Intronic
1140558886 16:75954404-75954426 ACTCCCACTCAGGATCCACGCGG + Intergenic
1141133760 16:81452444-81452466 CCACCAACACAGGCTCCACGAGG - Intronic
1143149930 17:4801510-4801532 CCCCCAACCCAGGGTTGAGGAGG + Intergenic
1146635370 17:34500216-34500238 CCTCCATCCCAGCATCCACATGG + Intergenic
1151701411 17:75744479-75744501 CCTACAACTCAGGATCCACAGGG + Intronic
1162198021 19:9000533-9000555 CCTCCAGCCCAGGATGGCCCCGG + Intergenic
1166310111 19:41958056-41958078 CCTCAAACCCAGGATCCACCTGG - Intronic
1168276433 19:55280967-55280989 CCTCCTATCCAGGATCAACACGG - Intergenic
948049059 2:234965737-234965759 CCTCCAACACAGGTTCGCTGTGG - Intronic
948364475 2:237445906-237445928 CCTCCCACCCAGGCTTGTCGTGG + Intergenic
1173662800 20:44745820-44745842 CCTCCAACCCCGGCCCCACGCGG - Exonic
1173786121 20:45793963-45793985 CCTGCAGCCCAGCATCAACGAGG + Exonic
1180151203 21:45948980-45949002 CTTCCAAAGCAGGATGGACGGGG - Intergenic
1180469866 22:15644024-15644046 GCTCCAAGCCAGGATGGAGGAGG + Intergenic
1180997776 22:19973984-19974006 CCACCACCCCAGGATCCAAGAGG - Intronic
971235457 4:24837893-24837915 CCTCCTAGCCAGGATAGACAGGG - Intronic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
1000622911 5:163505624-163505646 CCTCCAACCCAGGATCGACGCGG - Exonic
1005996055 6:30932102-30932124 CCTCCATCCCAGGAGCGCAGTGG - Exonic
1007390694 6:41548058-41548080 CCCCCAACCTAGGATCGGGGTGG - Intronic
1008104246 6:47425449-47425471 CCCCCAACCCAGGACAGACAGGG - Intergenic
1011437670 6:87355881-87355903 CCTCCTACCCAGGAGACACGAGG + Intronic
1013830983 6:114272650-114272672 CCTTCAGCCCAGGATCCACGTGG + Intronic
1017012024 6:150069374-150069396 CCTCCACCCCAGGCTCCGCGCGG + Intergenic
1018950310 6:168374557-168374579 CCTCCAGCCCAGCCTCGGCGAGG - Intergenic
1019942661 7:4303416-4303438 CCTGCAGCCCAGGACCGATGAGG + Intergenic
1023089843 7:36607688-36607710 CCTCAAGCCCAGGATGGACAGGG - Intronic
1025201470 7:56964549-56964571 GCTCCACCCCAGGGTCTACGTGG - Intergenic
1025670475 7:63612383-63612405 GCTCCACCCCAGGGTCTACGTGG + Intergenic
1029118750 7:98252305-98252327 CCTCGAAGCCAGCACCGACGCGG - Intergenic
1033977333 7:147117408-147117430 CAGCCTACCCAGGAGCGACGTGG - Intronic
1034551257 7:151822251-151822273 CCTCGAGCCCAGGAACGAGGTGG + Intronic
1050138257 9:2490913-2490935 CATCCAAGCCAGGTTCTACGTGG + Intergenic
1051235085 9:14991101-14991123 CCTGCAAACCAGGATCACCGAGG - Intergenic
1190664357 X:52683480-52683502 ACTCCATGCCAGGATGGACGTGG + Intronic
1190675065 X:52774942-52774964 ACTCCATGCCAGGATGGACGTGG - Intronic
1199762144 X:150913067-150913089 CCACCAACCCAGGCTCCACATGG + Intergenic
1199771440 X:150977762-150977784 CCTCCAACCCAGCCTCCTCGTGG - Intergenic