ID: 1000626929

View in Genome Browser
Species Human (GRCh38)
Location 5:163549252-163549274
Sequence TCGGGCTCACTGAATGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000626919_1000626929 4 Left 1000626919 5:163549225-163549247 CCAGCAAAAGCCCGCCCTTCCGG No data
Right 1000626929 5:163549252-163549274 TCGGGCTCACTGAATGTGTGTGG No data
1000626925_1000626929 -7 Left 1000626925 5:163549236-163549258 CCGCCCTTCCGGAGGCTCGGGCT No data
Right 1000626929 5:163549252-163549274 TCGGGCTCACTGAATGTGTGTGG No data
1000626926_1000626929 -10 Left 1000626926 5:163549239-163549261 CCCTTCCGGAGGCTCGGGCTCAC No data
Right 1000626929 5:163549252-163549274 TCGGGCTCACTGAATGTGTGTGG No data
1000626924_1000626929 -6 Left 1000626924 5:163549235-163549257 CCCGCCCTTCCGGAGGCTCGGGC No data
Right 1000626929 5:163549252-163549274 TCGGGCTCACTGAATGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000626929 Original CRISPR TCGGGCTCACTGAATGTGTG TGG Intergenic
No off target data available for this crispr