ID: 1000628468

View in Genome Browser
Species Human (GRCh38)
Location 5:163565823-163565845
Sequence CTCTGAACGCGTGCCCGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000628468_1000628474 15 Left 1000628468 5:163565823-163565845 CCATACCGGGCACGCGTTCAGAG No data
Right 1000628474 5:163565861-163565883 ACTTTTCCTTAGCTTTATTTTGG No data
1000628468_1000628477 25 Left 1000628468 5:163565823-163565845 CCATACCGGGCACGCGTTCAGAG No data
Right 1000628477 5:163565871-163565893 AGCTTTATTTTGGAAGCAGTGGG No data
1000628468_1000628476 24 Left 1000628468 5:163565823-163565845 CCATACCGGGCACGCGTTCAGAG No data
Right 1000628476 5:163565870-163565892 TAGCTTTATTTTGGAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000628468 Original CRISPR CTCTGAACGCGTGCCCGGTA TGG (reversed) Intergenic
No off target data available for this crispr