ID: 1000635696

View in Genome Browser
Species Human (GRCh38)
Location 5:163641381-163641403
Sequence AGTTCTCAGCAGTAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000635687_1000635696 27 Left 1000635687 5:163641331-163641353 CCAGTCAGTTGAGGGCAGGGGAG No data
Right 1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG No data
1000635692_1000635696 -2 Left 1000635692 5:163641360-163641382 CCATCAATAACCTGAGGGGTCAG No data
Right 1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG No data
1000635691_1000635696 -1 Left 1000635691 5:163641359-163641381 CCCATCAATAACCTGAGGGGTCA No data
Right 1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000635696 Original CRISPR AGTTCTCAGCAGTAGGGACA TGG Intergenic
No off target data available for this crispr