ID: 1000644473

View in Genome Browser
Species Human (GRCh38)
Location 5:163744312-163744334
Sequence GAAGCGGGTAGAAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000644473_1000644481 26 Left 1000644473 5:163744312-163744334 CCCAGCTCCCTTCTACCCGCTTC No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000644473 Original CRISPR GAAGCGGGTAGAAGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr