ID: 1000644474

View in Genome Browser
Species Human (GRCh38)
Location 5:163744313-163744335
Sequence AGAAGCGGGTAGAAGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000644474_1000644481 25 Left 1000644474 5:163744313-163744335 CCAGCTCCCTTCTACCCGCTTCT No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000644474 Original CRISPR AGAAGCGGGTAGAAGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr