ID: 1000644477

View in Genome Browser
Species Human (GRCh38)
Location 5:163744327-163744349
Sequence GACTGGAGACTGATAGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000644477_1000644481 11 Left 1000644477 5:163744327-163744349 CCCGCTTCTATCAGTCTCCAGTC No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000644477 Original CRISPR GACTGGAGACTGATAGAAGC GGG (reversed) Intergenic
No off target data available for this crispr