ID: 1000644479

View in Genome Browser
Species Human (GRCh38)
Location 5:163744344-163744366
Sequence AAAAGATGGCATCAATAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000644479_1000644483 18 Left 1000644479 5:163744344-163744366 CCAGTCTATTGATGCCATCTTTT No data
Right 1000644483 5:163744385-163744407 AAGCTCTTGCTTTGTTACCCAGG No data
1000644479_1000644485 22 Left 1000644479 5:163744344-163744366 CCAGTCTATTGATGCCATCTTTT No data
Right 1000644485 5:163744389-163744411 TCTTGCTTTGTTACCCAGGTGGG 0: 8
1: 408
2: 8778
3: 76594
4: 158086
1000644479_1000644481 -6 Left 1000644479 5:163744344-163744366 CCAGTCTATTGATGCCATCTTTT No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644479_1000644484 21 Left 1000644479 5:163744344-163744366 CCAGTCTATTGATGCCATCTTTT No data
Right 1000644484 5:163744388-163744410 CTCTTGCTTTGTTACCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000644479 Original CRISPR AAAAGATGGCATCAATAGAC TGG (reversed) Intergenic
No off target data available for this crispr