ID: 1000644481

View in Genome Browser
Species Human (GRCh38)
Location 5:163744361-163744383
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000644477_1000644481 11 Left 1000644477 5:163744327-163744349 CCCGCTTCTATCAGTCTCCAGTC No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644472_1000644481 27 Left 1000644472 5:163744311-163744333 CCCCAGCTCCCTTCTACCCGCTT No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644471_1000644481 30 Left 1000644471 5:163744308-163744330 CCTCCCCAGCTCCCTTCTACCCG No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644473_1000644481 26 Left 1000644473 5:163744312-163744334 CCCAGCTCCCTTCTACCCGCTTC No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644479_1000644481 -6 Left 1000644479 5:163744344-163744366 CCAGTCTATTGATGCCATCTTTT No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644475_1000644481 19 Left 1000644475 5:163744319-163744341 CCCTTCTACCCGCTTCTATCAGT No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644478_1000644481 10 Left 1000644478 5:163744328-163744350 CCGCTTCTATCAGTCTCCAGTCT No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644476_1000644481 18 Left 1000644476 5:163744320-163744342 CCTTCTACCCGCTTCTATCAGTC No data
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data
1000644474_1000644481 25 Left 1000644474 5:163744313-163744335 CCAGCTCCCTTCTACCCGCTTCT 0: 1
1: 0
2: 1
3: 33
4: 377
Right 1000644481 5:163744361-163744383 TCTTTTTTTTTTTGTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000644481 Original CRISPR TCTTTTTTTTTTTGTCCTTG AGG Intergenic