ID: 1000646804

View in Genome Browser
Species Human (GRCh38)
Location 5:163769444-163769466
Sequence TGTACAGGGTGCAGAGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000646804_1000646815 23 Left 1000646804 5:163769444-163769466 CCCATAGCTCTGCACCCTGTACA No data
Right 1000646815 5:163769490-163769512 TTGGCTTCTGGGGAGGCCTCAGG 0: 251
1: 692
2: 1865
3: 2604
4: 2517
1000646804_1000646813 13 Left 1000646804 5:163769444-163769466 CCCATAGCTCTGCACCCTGTACA No data
Right 1000646813 5:163769480-163769502 TGGCATCTGTTTGGCTTCTGGGG No data
1000646804_1000646809 -7 Left 1000646804 5:163769444-163769466 CCCATAGCTCTGCACCCTGTACA No data
Right 1000646809 5:163769460-163769482 CTGTACAGGAAGCATGATGCTGG 0: 244
1: 541
2: 827
3: 1015
4: 1576
1000646804_1000646814 16 Left 1000646804 5:163769444-163769466 CCCATAGCTCTGCACCCTGTACA No data
Right 1000646814 5:163769483-163769505 CATCTGTTTGGCTTCTGGGGAGG No data
1000646804_1000646812 12 Left 1000646804 5:163769444-163769466 CCCATAGCTCTGCACCCTGTACA No data
Right 1000646812 5:163769479-163769501 CTGGCATCTGTTTGGCTTCTGGG No data
1000646804_1000646810 4 Left 1000646804 5:163769444-163769466 CCCATAGCTCTGCACCCTGTACA No data
Right 1000646810 5:163769471-163769493 GCATGATGCTGGCATCTGTTTGG No data
1000646804_1000646811 11 Left 1000646804 5:163769444-163769466 CCCATAGCTCTGCACCCTGTACA No data
Right 1000646811 5:163769478-163769500 GCTGGCATCTGTTTGGCTTCTGG 0: 12
1: 215
2: 427
3: 814
4: 1096

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000646804 Original CRISPR TGTACAGGGTGCAGAGCTAT GGG (reversed) Intergenic
No off target data available for this crispr