ID: 1000648810

View in Genome Browser
Species Human (GRCh38)
Location 5:163790200-163790222
Sequence TGCAGCTGCACAGCAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000648807_1000648810 -5 Left 1000648807 5:163790182-163790204 CCACAGGACCTGCCTCATTGCAG No data
Right 1000648810 5:163790200-163790222 TGCAGCTGCACAGCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000648810 Original CRISPR TGCAGCTGCACAGCAAATGC TGG Intergenic
No off target data available for this crispr