ID: 1000649155

View in Genome Browser
Species Human (GRCh38)
Location 5:163794497-163794519
Sequence TGTATGCTATAATACTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000649151_1000649155 19 Left 1000649151 5:163794455-163794477 CCTTGGCAGAAAAACAATAAAAA No data
Right 1000649155 5:163794497-163794519 TGTATGCTATAATACTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000649155 Original CRISPR TGTATGCTATAATACTGTGG TGG Intergenic
No off target data available for this crispr