ID: 1000652839

View in Genome Browser
Species Human (GRCh38)
Location 5:163838083-163838105
Sequence AAGTGTGCCAAGCGCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000652834_1000652839 21 Left 1000652834 5:163838039-163838061 CCCAGTCTCATGGGAGAACAGAC No data
Right 1000652839 5:163838083-163838105 AAGTGTGCCAAGCGCAAGGATGG No data
1000652835_1000652839 20 Left 1000652835 5:163838040-163838062 CCAGTCTCATGGGAGAACAGACG No data
Right 1000652839 5:163838083-163838105 AAGTGTGCCAAGCGCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000652839 Original CRISPR AAGTGTGCCAAGCGCAAGGA TGG Intergenic
No off target data available for this crispr