ID: 1000653320

View in Genome Browser
Species Human (GRCh38)
Location 5:163845212-163845234
Sequence AGGTAGGAGAGTCTGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000653315_1000653320 -8 Left 1000653315 5:163845197-163845219 CCTTCCATCTGCTAGAGGTAGGA No data
Right 1000653320 5:163845212-163845234 AGGTAGGAGAGTCTGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000653320 Original CRISPR AGGTAGGAGAGTCTGGGGCA TGG Intergenic
No off target data available for this crispr