ID: 1000656530

View in Genome Browser
Species Human (GRCh38)
Location 5:163885957-163885979
Sequence AGTACAGGCAAAGTACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000656530_1000656532 -8 Left 1000656530 5:163885957-163885979 CCTGTGGGTACTTTGCCTGTACT No data
Right 1000656532 5:163885972-163885994 CCTGTACTGTATCTCTTACTTGG No data
1000656530_1000656533 -3 Left 1000656530 5:163885957-163885979 CCTGTGGGTACTTTGCCTGTACT No data
Right 1000656533 5:163885977-163885999 ACTGTATCTCTTACTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000656530 Original CRISPR AGTACAGGCAAAGTACCCAC AGG (reversed) Intergenic
No off target data available for this crispr