ID: 1000663456

View in Genome Browser
Species Human (GRCh38)
Location 5:163965040-163965062
Sequence CCATTGTGTCATGTTTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000663456_1000663458 -4 Left 1000663456 5:163965040-163965062 CCTGCAGAAACATGACACAATGG No data
Right 1000663458 5:163965059-163965081 ATGGTGATATTTTTATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000663456 Original CRISPR CCATTGTGTCATGTTTCTGC AGG (reversed) Intergenic
No off target data available for this crispr