ID: 1000663800 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:163969759-163969781 |
| Sequence | CTATAGTCACATTGGGGGTT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1000663791_1000663800 | 0 | Left | 1000663791 | 5:163969736-163969758 | CCTCCTAAAGACCCTATCTCCAG | No data | ||
| Right | 1000663800 | 5:163969759-163969781 | CTATAGTCACATTGGGGGTTAGG | No data | ||||
| 1000663792_1000663800 | -3 | Left | 1000663792 | 5:163969739-163969761 | CCTAAAGACCCTATCTCCAGCTA | No data | ||
| Right | 1000663800 | 5:163969759-163969781 | CTATAGTCACATTGGGGGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1000663800 | Original CRISPR | CTATAGTCACATTGGGGGTT AGG | Intergenic | ||
| No off target data available for this crispr | |||||