ID: 1000663800

View in Genome Browser
Species Human (GRCh38)
Location 5:163969759-163969781
Sequence CTATAGTCACATTGGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000663791_1000663800 0 Left 1000663791 5:163969736-163969758 CCTCCTAAAGACCCTATCTCCAG No data
Right 1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG No data
1000663792_1000663800 -3 Left 1000663792 5:163969739-163969761 CCTAAAGACCCTATCTCCAGCTA No data
Right 1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000663800 Original CRISPR CTATAGTCACATTGGGGGTT AGG Intergenic
No off target data available for this crispr